Cell viability was assessed via trypan blue exclusion. PH (106 cells) were seeded in 10 cm pre-coated tissue culture plates (BD Primaria™, BD Biosciences) in Wash/Plating Medium as described above, allowed to attach overnight, followed by a medium change 24 h post-seeding. F4/80+ resident MΦ were FACS-sorted directly onto 6-well pre-coated tissue culture plates (50,000 cells/well; BD Primaria™, BD Biosciences) in Dulbecco's Modified Eagle's Medium (DMEM) with 10% FBS. VE-cad+CD45- SEC were FACS-sorted directly onto fibronectin-coated 48-well tissue culture plates (2,000 cells/well) in Endothelial Cell Growth Medium-2 (EGM-2; Lonza Inc., Allendale, NJ). All cultures were incubated at 37°C with 5% CO2 and observed daily.
Primaria
Manufactured by BD
Sourced in United States
Primaria is a versatile laboratory equipment product designed for a range of applications. It serves as a core component in various experimental setups, providing a stable and reliable platform for various laboratory procedures. The product's function is to facilitate consistent and reproducible results, enabling researchers to conduct their work effectively.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Primesurface, by Sumitomo Bakelite (1 mentions)
Aim 5 medium, by Thermo Fisher Scientific (1 mentions)
Gm csf, by Miltenyi Biotec (1 mentions)
Interleukin 4 (il 4), by Miltenyi Biotec (1 mentions)
Rpmi 1640 medium, by Fujifilm (1 mentions)
Fetal bovine serum (fbs), by Equitech-Bio (1 mentions)
Epidermal growth factor (egf), by Thermo Fisher Scientific (1 mentions)
Insulin, by Merck Group (1 mentions)
Hydrocortisone, by Merck Group (1 mentions)
Transferrin, by Merck Group (1 mentions)
Sodium selenite, by Merck Group (1 mentions)
Dharmafect duo, by Horizon Discovery (1 mentions)
Siglo, by Horizon Discovery (1 mentions)
Laminin, by Merck Group (1 mentions)
Accutase, by Merck Group (1 mentions)
Methyl thiazolyl tetrazolium (mtt), by Merck Group (1 mentions)
Stem cell factor (scf), by Fujifilm (1 mentions)
21 protocols using primaria
1
Liver cell culture and viability
2
Generation of IL4-Modulated Dendritic Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IL4−DCs were generated using previously reported low−adherence cell culture maturation protocols [25 (link)]. PBMCs from patients were suspended in AIM−V medium (serum−free medium, Thermo Fisher Scientific, Inc., Waltham, MA, USA), placed into adherent dishes (Primaria, BD Biosciences, San Jose, CA, USA), and incubated for 18–24 h. After removing non−adherent cells, 100 ng/mL of GM−CSF and 50 ng/mL of IL-4 (Miltenyi Biotec B.V. & Co. KG, Bergisch Gladbach, Germany) were added the following day. Cells were cultured for 5 days to generate immature DCs. Immature DCs were differentiated by matured by stimulation with OK−432 (10 μg/mL, streptococcal preparation; Chugai Pharmaceutical Co., Ltd., Tokyo, Japan), PGE2 (10 ng/mL; Kyowa Pharma Chemical Co., Ltd., Toyama, Japan), 20 μg/mL of the WT1 peptides reconstituted with dimethyl sulfoxide (DMSO) (for WT1−235 killer peptide: CYTWNQMNL, residues 235–243: for WT1−34 helper peptide: WAPVLDFAPPGASAYGSL, residues 34–51; Peptide Institute, Inc., Osaka, Japan) for 24 h in either Prime surface (Sumitomo Bakelite, Tokyo, Japan) for the low−adherent dish or EZSPHERE (AGC TECHNO GLASS Co., Ltd., Shizuoka, Japan) for the cluster−controlled dish.
3
PC12 Cell Differentiation and Neurite Outgrowth
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PC12 cells were purchased from DS Pharma Biomedical Co., Ltd. (Osaka, Japan) and maintained in RPMI 1640 medium (Wako, Osaka, Japan) supplemented with 10% horse serum (Gibco) and 5% fetal bovine serum (FBS, Equitech-Bio, Inc., Kerrville, TX, USA) in tissue culture flasks (Primaria, BD Biosciences). Cells were dissociated by pipetting and plated on 12-well multiplates with or without PuraMatrix equilibrated with culture medium as described above. Immediately or 1 day after plating, nerve growth factor (NGF, 50 ng/mL in medium; BD Biosciences) was added to the cells to induce neuron-like differentiation. Cell morphology and neurite length were observed using an inverted microscope (Ti-S, Nikon, Tokyo, Japan).
4
Human Corneal Endothelial Cell Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The culture conditions of HCECs and their isogenic series have been reported elsewhere [13 (link)]. Briefly, HCECs were maintained under 2% oxygen and 5% carbon dioxide on Primaria® (BD Biosciences, San Jose, CA) plates in 4:1 high-glucose Dulbecco modified Eagle medium/medium 199 with 2% cosmic calf serum (Hyclone, Logan, UT) plus growth supplements: epidermal growth factor (EGF; 20 ng/ml; Peprotech, Rocky Hill, NJ), hydrocortisone (1 mg/ml), insulin (10 mg/ml), transferrin (2 mg/ml), and sodium selenite (5 nM) (all Sigma, St Louis, MO).
5
Canine Transcription Factor Silencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Canine sequence-specific LEF1 (synonym: TCF1-alpha, Genbank: XM_003434032) and β-catenin (CTNNB1, Genbank: NM_001137652) siRNA was designed on the website http://www.dharmacon.com/designcenter/designcenterpage.aspx (DharmaconRNAi technologies, ThermoScientific, USA). Universal MOCKsiRNA (ON-TARGET plus non-targeting pool species H, M, R) was used as the negative control for siRNA experiments. There was no cross-silencing of non-target genes checked by blasting the siRNA designed sequences against the canine genome database. The sequence of the LEF1 siRNA duplex is as follows: sense GAAGAGGAAGAGAGAGAAAUU and antisense UUUCUCUCUCUUCCUCUUCUU, and for β-catenin sense GAACGAAGGUGUAGCAACAUU and antisense UGUUGCUACACCUUCGUUCUU. Cell transfections were first optimized with siGLO (Dharmacon, Colorado) (data not shown). 80.000 CMT-U27 cells were transfected with 1 µl DharmaFECT Duo as transfection reagent (Dharmacon, Colorado), 50 nM siRNA and 0.5 µg DNA (TOP or FOP) in 24 wells plates (Primaria, BD, The Netherlands). After 24 h and 48 h incubation in DMEM:F12 and 10% FCS cells were harvested for RNA isolation or TCF-reporter assay.
6
Infection Kinetics of E. coli in Bladder Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell experiments were carried out in 24 well cell culture plates. TERT-NHUC cells were cultured in Primaria (BD). All other cell lines T-24, 5637, differentiated HL-60 (dHL-60) and differentiated THP-1 (dTHP-1) were cultured in Costar plates. Cells were grown in the presence of 5µM SC-236 for 24 h prior to the infection. After 24 h, old media was removed and replaced with fresh media supplemented with 5µM of SC-236, without antibiotics and serum. 106 CFU/ml (MOI 5) or 2 × 106 CFU/ml (MOI 10) of E. coli CFT073 were added to nearly confluent pre-treated cells and incubated in 37 °C at 5% CO2 and 80% humidity. At pre-set time points like 15, 30, 60 and 120 min, cells were washed once with PBS and harvested for further analysis.
7
Primary GBM Cell Line Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary GBM cell lines were created from freshly isolated tumor resection tissue as previously described [37 (link)]. Briefly, primary GBM tumor tissue was cleaned manually of RBCs, mechanically dissociated with forceps and scalpel, and chemically dissociated with Accutase (Sigma). Cells were then spun down and triturated gently. Cells were then plated on PLO (Sigma) and Laminin (Sigma) coated Primaria plates (BD Biosciences). Cells were used for experiments after the fifth passage. Media is RHB-A with EGF (10ng/mL) and FGF (10ng/mL).
8
MTT Assay for Cell Viability
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell viability was determined by means of the colorimetric 3-[4,5-dimethylthiazol-2-yl] 2,5-diphenyltetrazolium bromide assay (MTT) (Sigma Aldrich, Zwijndrecht, The Netherlands). Briefly, cells were seeded in 96 wells plates (Primaria, BD Biosciences, Breda, The Netherlands) and after 24 h incubation to attach and stretch, treated with the different compounds for 40 h. Cell viability was determined by incubating 20 μl 5 mg/ml MTT in 100 μl medium in each well. After a 2 h incubation, the media was removed by decanting and 100 μl DMSO was added to each well, incubated for 30 min and the absorbance was measured at 595 nm in a spectrophotometer Anthos Multimode Detector (Anthos Mikrosystem GmbH, Krefeld, Germany). IC50 curves were plotted with Sigma-plot version 12.5.
9
Uroepithelial Cell Response to E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell experiments were carried out in 24 well cell culture plates, human uroepithelial cells TERT-NHUC in Primaria (BD) and 5637 cells in Costar plates. Cells were grown in the presence of 5 or 6, 11 and 30 mM glucose, respectively. All media were antibiotic and serum free. A total 106 CFU/ml (MOI 5) or 2 × 106 CFU/ml (MOI 10) of E. coli CFT073 were added to nearly confluent pre-treated cells and incubated in 37 °C at 5% CO2 and 80% humidity. At time points 5, 15, 30, 60 and 120 mins, cells were washed once with PBS and harvested for further analysis.
10
Expansion of CD34+ Hematopoietic Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At first, 50,000 PB-CD34+ cells in 2 ml of medium were plated into each well of a six-well tissue culture dish (Primaria; BD Biosciences, San Diego, CA) and cultured in a suspension manner using serum-free culture medium (StemSpam SFEM; StemCell Technologies, Vancouver, Canada) containing 50 ng/ml VEGF (Wako, Richmond, VA), 100 ng/ml stem cell factor (Wako), 20 ng/ml interleukin-6 (Wako), 100 ng/ml Flt-3 ligand (Wako), and 20 ng/ml thrombopoietin (Wako) for 7 days, as described previously.22 (link),35–37
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!