The total RNA from mammary gland tissues and cells was extracted using Trizol regent according to the manufacturer's recommendation (Invitrogen, USA). The concentration and purity of the total RNA were measured spectrophotometrically using the 260/280 nm ratio; then the RNA was reverse transcribed as cDNA. The cDNA was diluted fivefold with sterile water and stored at −80°C. The primers used for measuring steady state levels of mRNA are shown in Table 1. The amplification conditions were as follows: 95°C for 10 min, 40 cycles of 95°C for 15s, 60°C for 60s, and 72°C for 60s. The PCR reaction system (20 μl in total) contained 10μl SYBR qPCR Mix (Roche, Basel, Switzerland), 1μl of each primer, 1 μl cDNA, and 7μl nuclease-free water. Expression levels of each target gene were standardized to the corresponding GAPDH threshold cycle (Ct) values using the 2−ΔΔCt comparative method.
Sybr qpcr mix
Manufactured by Roche
Sourced in Switzerland
SYBR qPCR Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) amplification and detection of DNA sequences using the SYBR Green dye. The mix contains all necessary components, including a hot-start DNA polymerase, dNTPs, and SYBR Green I, optimized for reliable and sensitive qPCR performance.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Reverse transcription kit, by Takara Bio (2 mentions)
Trizol regent, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Bio-Rad (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Lightcycler 480 instrument 2, by Roche (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
6 protocols using sybr qpcr mix
1
Mammary Gland RNA Extraction and qPCR Analysis
2
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from collected cells using the TRIzol reagent (Invitrogen, USA) and reverse transcription to synthesise cDNA was performed using a reverse transcription kit (Takara, Japan). The primer sequences used are shown in Table 1 . Quantitative real‐time PCR mixture reagents contains 1 μL forward and reverse primers, 1 μL of cDNA, 10 μL SYBR qPCR Mix (Roche, Swiss) and 7 μL TE water and on a StepOne Plus™ Real‐Time PCR System (BIO‐RAD, USA). The target genes expression level was evaluated using the 2−ΔΔCt comparative approach.
3
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of different cells groups was isolated using TRIzol reagent (Life technogies) according to the instruction manual. An ultraviolet spectrophotometer was used to measure the concentration and purity of total RNA. The first-strand cDNA was synthesized by Vic qRT Super kit (Vicmed Biotech) and qPCR using SYBR® qPCR Mix (Roche, Basel, Switzerland) and implemented on LightCycler® 480 real-time fluorescence quantitative real-time PCR (Roche). qRT-PCR conditions were as follows: 30 sec at 95°C, 30 sec at 59°C and 1 min at 72°C for 40 cycles; 95°C for 2 min, followed by 40 cycles of 95°C for 1.5 sec and 60°C for 60 sec. GAPDH was used as reference gene and qRT-PCR was performed with three technical replicates for each sample on the same plate. Dissolution curve was used to analyze the characteristics of the PCR products. Relative expression levels of CUEDC2 gene were calculated by the 2−ΔΔCt formula.
4
Quantitative RT-PCR Analysis of CEP55 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) in accordance with the manufacturer's protocol. RNA was reverse transcribed into cDNA using Vic qRT Super kit (Vicmed), according to the manufacturer's protocol. qPCR was performed using SYBR qPCR mix (Roche Diagnostics, Basel, Switzerland), run on a Light Cycler 480 Instrument II (Roche Diagnostics). The reactions were incubated in a 96-well optical plate at 95°C for 10 min for 40 cycles of 95°C for 10 sec, 60°C for 20 sec and 72°C for 30 sec. GAPDH was used as an internal control, and the relative expression levels of the gene of interest were calculated using the 2−ΔΔCq method (18 (link)). The sequences of the primers are as follows: CEP55 forward, 5′-GAGGATCCCCGGGTACCGGTCGCCACCATGTCTTCCAGAAGTACCAAAG-3′ and reverse, 5′-TCCTTGTAGTCCATACCCTTTGAACAGTATTCCACATGGAC-3′; GAPDH forward, 5′-CTCTCTGCTCCTCCTGTTCGAC-3′ and reverse, 5′-TGAGCGATGTGGCTCGGCT-3′. All RT-qPCRs were performed in triplicate.
5
Spinal Neuroimmune Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ipsilateral spinal enlargements L3-L5 of the sham and SNL groups from 4 rats in each group were gently isolated into cold ACSF. Total RNA was extracted using TRIzol, and the ratio of 260/280 > 1.8 was chosen for further experiments. Using the First Strand cDNA Synthesis Kit (Thermal, K1622), 1 μg mRNA was used for cDNA synthesis. The primers used were as follows: proopiomelanocortin (POMC) (exon 2–3) forward primer: CCTATCGGGTGGAGCACTTC and reverse primer: TGGCTCTTCTCGGAGGTCAT, IL-10 forward primer: GGCTCAGCA CTGCTATGTTGCC and reverse primer: AGCATGTGGGTCTGGCTGACTG, and GAPDH forward primer: CCAAGGTCATCCATGACGAC and TCCACAGTCTTCTGAGTGGC. All primers were manufactured according to a previous study [11 (link)]. Real-time quantitative PCR was performed using Roche SYBR qPCR Mix and identified to be specific as assessed by a melting curve. The relative expression of IL-10 and POMC was calculated using the 2-ΔΔCT method after normalization to GAPDH.
6
Relative Quantification of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from RAW264.7 cells with TRIzol (Invitrogen, USA). Next, cDNA was synthesized using a reverse transcription kit (Takara, Japan) and primers, which are shown in Table 1 . The PCR reaction (40 cycles) was performed using a SYBR qPCR Mix (Roche, Swiss). The housekeeping gene GAPDH served as an internal standard. The relative quantification of the target gene expression levels was calculated using the 2−ΔΔCt comparative approach.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!