Rneasy mini handbook

Manufactured by Qiagen

Sourced in Germany

The RNeasy Mini Handbook is a guide for the RNeasy Mini Kit, a product designed for the purification of total RNA from a variety of sample types. The handbook provides detailed protocols and instructions for using the kit.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (3 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Nanodrop 2000, by Thermo Fisher Scientific (2 mentions) Hybond n nylon membrane, by GE Healthcare (1 mentions) X ray film, by GE Healthcare (1 mentions) Klenow dnapolymerase 1, by New England Biolabs (1 mentions) Qiashredder, by Qiagen (1 mentions) Eukaryote total rna nano assay, by Agilent Technologies (1 mentions) Rneasy protect mini kit, by Qiagen (1 mentions) Micropoly a purist small scale mrna purification kit, by Thermo Fisher Scientific (1 mentions) Tissuelyzer, by Qiagen (1 mentions) Pmsf protease inhibitor, by Thermo Fisher Scientific (1 mentions) Imagequant las 4000, by GE Healthcare (1 mentions) Ambion trizol reagent, by Thermo Fisher Scientific (1 mentions) Iproof high fidelity dna polymerase, by Bio-Rad (1 mentions) Iscript cdna kit, by Bio-Rad (1 mentions) Histopaque 1077, by Merck Group (1 mentions)

10 protocols using rneasy mini handbook

RNA Hybridization Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For RNA hybridization analysis, 10 d seedlings were grinded in liquid
N₂, total RNA was extracted from 50 mg of grinded tissue using
TRIzol according to the manufacturers protocol (Invitrogen). RNA (10 μg) was
separated in 1.2% formaldehyde agarose gel electrophoresis according to the
protocol adapted from Rneasy Mini Handbook (QIAGEN), transferred to Hybond-N
nylon membrane (GE Healthcare) and fixed in an UV crosslinker at 70,000
microjoules/cm². Probes were ³²P radiolabeled with
α-³²P dCTP (Perkin Elmer Life Science Inc.) using Klenow DNA
polymerase I according to the protocol of the manufacturer (New England
Biolabs). Membranes containing RNA were hybridized for 4 h with the probes
tested and washed with a sodium chloride solution (7.5 mM)/sodium citrate (8.75
mM). The probe was detected after 8 h of exposure in an X-Ray film (GE
Healthcare). The assayed probes were amplified by PCR reactions from DNA using
the indicated oligonucleotides, YUC4 forward 5 GGAAATTCCGGTATGGAGGT 3’ and
reverse 5’ GCTCAATTGGTCCGGTCTTA 3’.

Munguía-Rodríguez A.G., López-Bucio J.S., Ruiz-Herrera L.F., Ortiz-Castro R., Guevara-García Á.A., Marsch-Martínez N., Carreón-Abud Y., López-Bucio J, & Martínez-Trujillo M. (2020). YUCCA4 overexpression modulates auxin biosynthesis and transport and influences plant growth and development via crosstalk with abscisic acid in Arabidopsis thaliana. Genetics and Molecular Biology, 43(1), e20190221.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis from Lung Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Timing: 1–2 days

In the steps below, RNA is extracted from the lung lysate using an RNeasy Mini Kit (Qiagen) and complementary DNA (cDNA) is synthesized using a High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific).

24.

To homogenize lung tissue completely, put the lysate prepared at the respective time points through a QIAshredder (Qiagen).

25.

Extract RNA using the RNeasy Mini Kit following the manufacturer’s instructions (RNeasy Mini Handbook - (EN) - QIAGEN).

26.

Measure the concentration of extracted RNA in a spectrophotometer.

27.

Perform reverse transcription to prepare complementary DNA (cDNA) using 1.5 μg of purified RNA obtained as described above. The reaction solution composition and conditions follow the manufacturer’s protocol (Document Connect (thermofisher.com)).

Matsumura R., Node K, & Akashi M. (2023). Detection of endogenous circadian rhythms of clock gene mRNA expression in mouse lung tissue using slice cultures. STAR Protocols, 4(2), 102280.

+ Open protocol

+ Expand

Total RNA Extraction from Cultured Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Collection of total RNA extracts was performed following the vendor’s instructions (RNeasy Mini Handbook from QIAGEN). About 1 x 10⁶ cells were collected, and disrupted in 350 μl of Buffer RLT from QIAGEN (RNeasy Protect Mini Kit) supplemented with 3.5 μl ß-mercaptoethanol. The suspension was homogenized, added to QIAshredder Spin Columns and centrifuged for 2 min at the highest speed. The supernatant was resuspended with 350 μl of ethanol 70% and transferred to RNeasy Mini Spin Columns. A sequence of centrifugations was performed with intermediate washing steps. Total RNA bound to the membrane was incubated with RNase-free DNase and eluted with RNase-free water according to the manufacturer´s instructions. Total RNA was quantified by using a Nanodrop 2000 device (Thermo Scientific, Wilmington, DE). Concentration and purity of samples was verified using Eukaryote Total RNA Nano assay (Agilent Technologies, Santa Clara, CA). To examine RNA integrity and DNA contamination, 1 μg of RNA was electrophoretic separated in an agarose gel. Samples were then saved at -80°C.

Branco A.F., Pereira S.P., Gonzalez S., Gusev O., Rizvanov A.A, & Oliveira P.J. (2015). Gene Expression Profiling of H9c2 Myoblast Differentiation towards a Cardiac-Like Phenotype. PLoS ONE, 10(6), e0129303.

+ Open protocol

+ Expand

Zebrafish Embryonic Total RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from pooled zebrafish embryos (2 petri dishes) per treatment using the Machery-Nagel (MN, Düren, Germany) NucleoSpin RNA L isolation kits. After shock-freezing with liquid nitrogen, the tissue was disrupted using a ceramic pestle and mortar. The cell homogenate was transferred to 3.6 ml lysis buffer and the following steps were done according to the NucleoSpin RNA L isolation kit instructions. The final product yielded 260 nm/280 nm ratios of 1.9–2.1, and concentrations were determined based on absorbance at 260 nm. The integrity of total RNA was confirmed by denaturing agarose gel electrophoresis according to the RNeasy Mini Handbook (Qiagen, Hilden, Germany). mRNA was purified from total RNA samples and precipitated over night according to the Ambion MicroPoly(A) Purist™ Small Scale mRNA Purification Kit instructions (Huntingdon, UK).

Bluhm K., Otte J.C., Yang L., Zinsmeister C., Legradi J., Keiter S., Kosmehl T., Braunbeck T., Strähle U, & Hollert H. (2014). Impacts of Different Exposure Scenarios on Transcript Abundances in Danio rerio Embryos when Investigating the Toxicological Burden of Riverine Sediments. PLoS ONE, 9(9), e106523.

+ Open protocol

+ Expand

Isolation and Labeling of IKBKBAS RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from BEAS-2B and LUAD cells using RNeasy® Mini Handbook (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. 3′-end-DIG-labeled IKBKBAS and β-actin probes were synthesized by Sangon Biotech (Shanghai, China). The detailed steps are similar to a previous study [53 (link)]. The sequences of DIG-labeled IKBKBAS and β-actin probes are listed in Supplementary Table 3.

Xing Y., Lin Y., Zhang Y., Hu J., Liu J., Tian Y., Zhao J., Chen W, & Han B. (2021). Novel cytoplasmic lncRNA IKBKBAS promotes lung adenocarcinoma metastasis by upregulating IKKβ and consequential activation of NF-κB signaling pathway. Cell Death & Disease, 12(11), 1004.

+ Open protocol

+ Expand

Worm RNA Extraction Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Before proceeding with the RNA extraction, the RNAlater was removed by centrifugation at maximum speed for 10 min at 4°C. RTL (250 µl, RNeasy Mini Kit, Qiagen) and 250 mg of glass beads were added to the samples. The worms were lysed using a TissueLyzer (Qiagen) at 20 Hz for 2 min and the procedure was repeated for 1 min. Samples were kept in ice whenever possible. After centrifugation of the lysed samples, the supernatants were transferred to a new RNAse-free Eppendorf tube and 1 volume of 70% ethanol was added. The procedure was then continued as described by the manufacturer (RNeasy Mini HandBook, Qiagen). The subsequent experimental steps for the qPCR analysis were performed by qStandard (UK).

Fernandes de Abreu D.A., Caballero A., Fardel P., Stroustrup N., Chen Z., Lee K., Keyes W.D., Nash Z.M., López-Moyado I.F., Vaggi F., Cornils A., Regenass M., Neagu A., Ostojic I., Liu C., Cho Y., Sifoglu D., Shen Y., Fontana W., Lu H., Csikasz-Nagy A., Murphy C.T., Antebi A., Blanc E., Apfeld J., Zhang Y., Alcedo J, & Ch'ng Q. (2014). An Insulin-to-Insulin Regulatory Network Orchestrates Phenotypic Specificity in Development and Physiology. PLoS Genetics, 10(3), e1004225.

+ Open protocol

+ Expand

qRT-PCR Validation of KS Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

To validate the results obtained via the NGS analysis of KS subjects described above, we compared gene expression in 10 KS patients and 10 normal subjects via qRT-PCR. In this step, the subjects studied in the NGS analysis were included. Once again, KS and control individuals were recruited in the study only after obtaining family and/or personal informed consent.
RNA extraction from peripheral blood leukocytes has been performed using RNeasy Mini Handbook (Qiagen Sciences, Germantown, USA), following the manufacturer's protocol.
2^-ΔΔCTqRT-PCR was performed with a Light Cycler 480 software v1.5 (Roche Molecular System Inc., Pleasanton, CA, USA) on KS subjects to measure gene expression and the results were compared with controls, as previously reported by Salemi et al. (2015) 26 (link).
Gene expression levels were then normalized to GAPDH level and target mean Cp (crossing point, cycle number at detection threshold) definition was used to indicate the mean normalized cycle threshold.
Distribution analysis of the expression values was performed using Shapiro - Wilk test and statistical analysis of results was carried out using the Wilcoxon rank-sum test. A p value <0.05 was been considered significant.
mRNA levels of the following mitochondrial subunits have been evaluated: ATP6, ATP8, CO1, CO2, CO3, MT-ND1, MT-ND2, MT-ND3, MT-ND4, MT-ND5 and MT-ND6.

Salemi M., Cimino L., Marino M., Cannarella R., Condorelli R.A., Romano C., La Vignera S, & Calogero A.E. (2018). Next Generation Sequencing expression profiling of mitochondrial subunits in men with Klinefelter syndrome. International Journal of Medical Sciences, 15(1), 31-35.

+ Open protocol

+ Expand

Protein Extraction and Analysis for Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols

Proteins for western blot were either harvested from cells lysed with NP40 Lysis Buffer (J619-500ML, Amrescor) supplemented with 0.1% PMSF Protease Inhibitor (36978, ThermoFisher Scientific, Waltham MA, United States) or during RNA-extraction according to the manual “Acetone Precipitation of Protein from Buffer RLT Lysates” (RNeasy Mini Handbook, Qiagen, Germany) during RNA extraction. CBX2 protein levels were visualized with an ImageQuant LAS 4000 (GE Healthcare, Life Sciences), using chemilumenescence. As a loading control, β-tubulin protein levels were analyzed.

Sproll P., Eid W, & Biason-Lauber A. (2019). CBX2-dependent transcriptional landscape: implications for human sex development and its defects. Scientific Reports, 9, 16552.

+ Open protocol

+ Expand

Extracting High-Quality RNA from Frozen CNS Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Frozen whole CNS tissue was shipped on dry ice to University of Vermont Cancer Center DNA Analysis Facility (Burlington, VT) for extraction. Tissue was stored at −80°C until RNA extraction. Frozen tissue was homogenized in 1 mL of Ambion® TRIzol® Reagent (LifeTech, #15596-026) using a sterile, autoclaved mortar, and pestle. RNA was extracted per the Ambion® TRIzol® protocol (LifeTech, MAN0001271) and purified using Qiagen RNeasy Mini Kit (Qiagen #74104) per manufacturers protocol (Qiagen RNeasy Mini Handbook, 06/2012).

Simpson S.D., Ramsdell J.S., Watson III W.H, & Chabot C.C. (2017). The Draft Genome and Transcriptome of the Atlantic Horseshoe Crab, Limulus polyphemus. International Journal of Genomics, 2017, 7636513.

+ Open protocol

+ Expand

Quantitative PCR Analysis of ENG mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral Blood Mononuclear Cells (PBMCs) were isolated using Histopaque ® -1077 (Sigma ® ) and total RNA was extracted from PBMCs using RNeasy ® Mini Handbook (Qiagen) according to the manufacturer's instructions. RNA samples were stored at -20°C until use.
Reverse transcriptase was performed using iScript cDNA kit (Bio-Rad) to retrotranscribe 350ng of total RNA for either patient or control, according to the manufacturer's instructions. The resulting cDNA was amplified using iProof High-Fidelity DNA Polymerase (Bio-Rad) and primers (For 5' -CAACTGTGTGAGCCTGCTGT -3'; Rev 5' -TATGCCATGCTGCTGGTG -3'). These primers were specifically designed from the middle sequence of exon 12 to the end of the coding region of exon 15 in order to include intron 14. In this way, we excluded the presence of genomic DNA amplification and distinguished between the two mRNA variants coding for S-ENG or L-ENG. qPCR experiments were performed using EXPRESS One-Step SYBR® GreenER™ with Premixed ROX (Invitrogen). β-actin (ACTB) was used as reference gene.
Primers used for ENG, ACVRL1 and ACTB amplification have been described elsewhere (Zucco et al. 2014) (link).

Plumitallo S., Ruiz-Llorente L., Langa C., Morini J., Babini G., Cappelletti D., Scelsi L., Greco A., Danesino C., Bernabeu C, & Olivieri C. (2018). Functional analysis of a novel ENG variant in a patient with hereditary hemorrhagic telangiectasia (HHT) identifies a new Sp1 binding-site. Gene, 647.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!