M17 neuroblastoma and HeLa cells were cultured in OptiMEM (Invitrogen), and when confluent, 1.75 × 104 cells/well plated to 24-well plates on coverslips. TDP-43 was knocked down for 72 h with 20 nM TARDBP siRNA (QIAGEN) (Prudencio et al, 2012 (link)) or All Star control siRNA (QIAGEN) and siLentFect reagent (Bio-Rad) and fixed in 4% PFA in DEPC-treated PBS and permeabilized. Nuclease treatment of HeLa cells was performed at 37°C for 30 min with 100 U/ml of RNase-free DNase I and RNase A (QIAGEN), ShortCut RNase III (NEB) or ultrapure benzonase nuclease (Sigma) each in their recommended buffers. Protein Block Serum Free (Dako) was used for blocking. Primary antibody incubation was done overnight in Antibody Diluent (Dako) with 0.25 μl/ml RNase OUT and 1:1,000 anti-TDP-43-Cterm (ProteinTech) and 1:1,000 J2, and secondary antibodies were 1:1,000 (donkey) anti-rabbit-AF488 and anti-mouse-AF568 (Alexafluor). Coverslips were counterstained with 0.1 μg/ml Hoechst. Images were taken by Zeiss AxioImager Z1 with Apotome at 63× with fixed exposures times.
Allstar control sirna
Manufactured by Qiagen
Sourced in United States
AllStar control siRNA is a laboratory reagent designed for use in gene silencing experiments. It serves as a non-targeting control siRNA, allowing researchers to assess the specificity of their siRNA-mediated knockdown studies.
Automatically generated - may contain errors
Lab products found in correlation
Apotome, by Zeiss (2 mentions)
Antibody diluent, by Agilent Technologies (1 mentions)
Silentfect reagent, by Bio-Rad (1 mentions)
Protein block serum free, by Agilent Technologies (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
Axio imager z1, by Zeiss (1 mentions)
Cell countess, by Thermo Fisher Scientific (1 mentions)
Fugene 6, by Promega (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Mca409, by Merck Group (1 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
Hiperfect, by Qiagen (1 mentions)
6 protocols using allstar control sirna
1
Knockdown of TDP-43 in Neuroblastoma and HeLa Cells
2
HMEC-1 Cell Viability Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cell counts were measured using a Coulter Counter or the Cell Countess (Invitrogen) where 2000 or 3000 cells/well were seeded onto a 96‐well plate. After 72 hours, the cells were serum‐arrested for 24 hours. Cells were then exposed to FGF‐2 or TRAIL for a further 72 hours with or without l ‐NAME or PEG‐catalase added 1 hour prior to TRAIL or FGF‐2 treatment. For experiments involving siRNA, growth‐quiescent HMEC‐1 cells were transfected with 200 nmol/L pooled human TRAIL, NOX4 (Santa Cruz Biotechnology), or AllStar control siRNA (Qiagen) for 3 to 6 hours using FuGENE6 (Promega), prior to the addition of TRAIL or FGF2 for 72 hours. Experiments were performed with at least 3 to 4 replicates for each treatment per independent experiment. Unless indicated, each experiment was performed at least 3 times; the data from each independent experiment were averaged and combined.
3
Modulating miR-382-5p and PTPN14 in Neuroblastoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Target-gene expression was determined in SK-N-BE(2) cells transfected with mirVana miR-382-5p mimic (1 pM) (Ambion, Thermo Fisher Scientific) or mirVana miRNA Mimic Negative control #1 (1 pM) (Ambion, Thermo Fisher Scientific), as well as mirVana miR-382-5p inhibitor (100 nM) (Ambion) or mirVana miRNA Inhibitor Negative control #1 (100 nM) (Ambion) using Lipofectamine 2000 (Life Technologies, Victoria, Australia) according to the manufacturer’s instructions. Cells were harvested 48 h post transfection.
Transfection with siRNAs was performed as previously described.9 (link) Briefly, SK-N-BE(2)/TGL and SH-SY5Y/TGL cells were transfected with PTPN14 siRNA sequence 3 (PTPN14 Seq3siRNA) (5′-GCUAAUGAGCCUUUGCUUU-3′), sequence 4 (PTPN14 Seq4siRNA) (5′-GGUGAGCACUACUCGGAAA-3′) (5 nM) (Dharmacon, CO, USA) or AllStar control siRNA (Qiagen) using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions.
Transfection with siRNAs was performed as previously described.9 (link) Briefly, SK-N-BE(2)/TGL and SH-SY5Y/TGL cells were transfected with PTPN14 siRNA sequence 3 (PTPN14 Seq3siRNA) (5′-GCUAAUGAGCCUUUGCUUU-3′), sequence 4 (PTPN14 Seq4siRNA) (5′-GGUGAGCACUACUCGGAAA-3′) (5 nM) (Dharmacon, CO, USA) or AllStar control siRNA (Qiagen) using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions.
4
Monoclonal Antibody-Based Protein Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Monoclonal antibodies were used against MBP (rat, Serotec, order no. (#) MCA409S) 1:500 in WB and 1:50 in Immunocytochemistry (ICC), CNPase (CNP, mouse, Sigma Aldrich, #C5922) 1:500 in WB and S100 (mouse, Merck-Millipore, clone 15E2E2, #MAB079-1) 1:200 in ICC. Polyclonal antibodies were used against GAPDH (rabbit, Bethyl, #A300-641A) 1:5000 in WB. Secondary antibodies were used from Dianova, (goat anti rat Cy2, #112-225-167) and Life Technologies (goat anti mouse, #A11031).
Double-DIG-labeled 715-specific LNA probe and 3’DIG-labeled U6 control probe used in Northern Blots were purchased from Exiqon (715LNA,5′CACGCGGGGGTGTGCACGAG3′ , order no. 39330–15; U6LNA, 5’CACGAATTTGCGTGTCATCCTT3’ , order no. 99002–05). 715-mimic (5′C-UCCGUGCACACCCCCGCGUG3’ , order no. MSY0003506) and Allstar control siRNA (order no. 1027280) were obtained from Qiagen. Primers specific for rat MBP: 5′AACATTGTGACACCTCGAACA3′ and 5′TGTCTCTTCCTCCCCAGCTA3′ ; and for rat glucose-6-phosphate dehydrogenase (G6PDH): 5’TGCAGCAGCTGTCCTCTATG3’ and 5’ACTTCAGCTTTGCGCTCATT3’ .
Double-DIG-labeled 715-specific LNA probe and 3’DIG-labeled U6 control probe used in Northern Blots were purchased from Exiqon (715LNA,
5
Knockdown of Snail, p53, and SGPL1 in MDA-MB-231 Cells
6
Transfecting SCs with siRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All short interference RNA (siRNA) were purchased from QIAGEN, with All star control siRNA (QIAGEN) used a control. In brief, 105 cells SCs were seeded on 6-well plates. The following day siRNA or control siRNA were mixed in plain DMEM with HiPerFect (QIAGEN) and incubated for 10 min at room temperature (RT) to allow complexes to form. Complexes were added to SCs for 16–18 hr, washed once with SC medium, and harvested or seeded for further experiments as appropriate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!