The DNA was denatured using 0.5 M NaOH and 1.5 M NaCl, and equal amounts were loaded onto a Hybond N + nitrocellulose membrane (GE Biosciences) using the Bio-Dot apparatus (Bio-Rad). Membranes were washed once with denaturing buffer and wash buffer (3× SSC), followed by UV-cross-linking (UV Stratalinker 1800, Stratagene) and blocking with 5× Denhardt’s solution (Thermo Scientific) for 1 h at 37 °C. Hybridization with Alu-Biotin (5′ biotin-GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCA), Satellite III (5′ biotin-TCCACTCGGGTTGATT) or LINE-1 (5′ biotin-GACTTCAAACTATACTACAAGGCTACA GTAACC) probes was performed at 37 °C overnight. Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific, 89880) was used for signal detection, and images were acquired using ChemiDox XRS with Image Lab software (Bio-Rad).
Denhardt s solution
Manufactured by Thermo Fisher Scientific
Denhardt's solution is a reagent commonly used in molecular biology techniques, such as Northern blotting and Southern blotting, to reduce non-specific binding of nucleic acids to membranes during hybridization experiments. It is a mixture of Ficoll, polyvinylpyrrolidone, and bovine serum albumin that helps to block non-specific binding sites on the membrane.
Automatically generated - may contain errors
Lab products found in correlation
Chemidox xrs, by Bio-Rad (2 mentions)
Hybond n nitrocellulose membrane, by GE Healthcare (2 mentions)
Bio dot apparatus, by Bio-Rad (2 mentions)
Chemiluminescent nucleic acid detection module kit, by Thermo Fisher Scientific (2 mentions)
Image lab software, by Bio-Rad (2 mentions)
Salmon sperm dna, by Thermo Fisher Scientific (2 mentions)
Formamide, by Merck Group (1 mentions)
Tween 20, by Thermo Fisher Scientific (1 mentions)
Paraformaldehyde (pfa), by Thermo Fisher Scientific (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (1 mentions)
T4 pnk, by Thermo Fisher Scientific (1 mentions)
Tbe urea sample buffer, by Thermo Fisher Scientific (1 mentions)
Rna clean and concentrator, by Zymo Research (1 mentions)
Oligo clean and concentrator, by Zymo Research (1 mentions)
Cot 1 dna, by Thermo Fisher Scientific (1 mentions)
Herculase 2 fusion polymerase, by Agilent Technologies (1 mentions)
6 mercapto 1 hexanol mch, by Merck Group (1 mentions)
Kh2po4, by Merck Group (1 mentions)
Formamide, by Thermo Fisher Scientific (1 mentions)
Platinum multiplex pcr master mix, by Thermo Fisher Scientific (1 mentions)
8 protocols using denhardt s solution
1
Quantitative Detection of Repetitive DNA Elements
2
Quantification of Repeat Sequences in DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA was denatured using 0.5 M NaOH and 1.5 M NaCl and equal amounts were loaded onto a Hybond N + nitrocellulose membrane (GE Biosciences) using the Bio-Dot apparatus (Bio-Rad).
Membranes were washed once with denaturing buffer and wash buffer (3× SSC), followed by UVcrosslinking (UV Stratalinker 1800, Stratagene) and blocking with 5× Denhardt's solution (Thermo Scientific) for 1 h at 37 °C. Hybridization with Alu-Biotin (5′ Biotin-GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCA), Satellite III (5′ Biotin-TCCACTCGGGTTGATT) or LINE-1 (5′ Biotin-GACTTCAAACTATACTACAAGGCTACA GTAACC) probes was performed at 37 °C overnight. Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific, 89880) was used for signal detection and images were acquired using ChemiDox XRS with Image Lab software (Bio-Rad).
Membranes were washed once with denaturing buffer and wash buffer (3× SSC), followed by UVcrosslinking (UV Stratalinker 1800, Stratagene) and blocking with 5× Denhardt's solution (Thermo Scientific) for 1 h at 37 °C. Hybridization with Alu-Biotin (5′ Biotin-GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCA), Satellite III (5′ Biotin-TCCACTCGGGTTGATT) or LINE-1 (5′ Biotin-GACTTCAAACTATACTACAAGGCTACA GTAACC) probes was performed at 37 °C overnight. Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific, 89880) was used for signal detection and images were acquired using ChemiDox XRS with Image Lab software (Bio-Rad).
3
Fluorescence-based Protein Localization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SPC-A1/DTX cells were seeded in glass chamber slides. 24 h after transfection, cells were fixed overnight in 4% paraformaldehyde (Thermo Scientific, Rockford, IL, USA), washed three times with PBS (5 min/wash), permeabilized with 0.5% Triton X-100/PBS permeation fluid at room temperature for 20 min, and again washed three times with PBS (5 min/wash). The slides were prehybridized for 1 h at 55°C with 100 mL of prehybridization buffer: 50% formamide (Sigma) + 5× saline sodium citrate (SSC) buffer + 5× Denhardt’s solution + 0.5% Tween 20 (Thermo Scientific). Then, slides were washed three times (10 min/wash) in 0.1× SSC (Ambion) at 55°C, followed by three washes (2 min/wash) in 1× PBS (Gibco) at room temperature. Slides were blocked in 10% heat-inactivated goat serum + 0.5% blocking reagent in PBS-Tween for 1 h at room temperature. In addition, 150 mL of anti-FAM-POD (the polyclonal antibody reacts with free and bound fluorescein to reduce the non-specific binding), diluted 1:40 in blocking buffer, was added to each slide, and the slides were incubated for 1 h at room temperature. The slides were washed twice (2 min/wash) in 1× PBS, 50 mL of Cy3-TSA substrate was diluted at 1: 50, and the slides were incubated in the dark for 10 min at room temperature. Finally, the slides were mounted with DAPI (Life Technologies) nuclear stain.
4
Northern Blot Analysis of Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from nuclear and cytoplasmic extracts was isolated using Trizol according to the manufacturer's protocol, then further purified using RNA Clean and Concentrator with DNase treatment (Zymo Research). 300 ng of total RNA was diluted 1:2 in 2X TBE-Urea Sample Buffer (ThermoFisher), heated to 65°C for 10 min, and separated on a 6% TBE-Urea gel (180 V, 1 hr) run at 4°C. RNA was transferred at 4°C to an Amersham HyBond-N +membrane in 0.5X TBE Buffer. The membrane was crosslinked using the Stratalinker 2400 (Stratagene, San Diego, CA) autocrosslink option. The membrane was blocked in pre-hybridization buffer (10X final concentration Denhardt’s Solution (ThermoFisher)), 6X final concentration SSC Buffer (ThermoFisher), 0.1% SDS, 10 μg/mL salmon sperm DNA (ThermoFisher) at 42°C for 2 hr.
DNA probes (10 μM stock, 2 uL probe per reaction) were labeled with P32 using T4 PNK (ThermoFisher) and purified using Oligo Clean and Concentrator (Zymo Research). Labeled oligos were incubated with membrane at 42°C while rotating overnight. Membranes were washed 4 × 1 hr with pre-hybridization buffer at 42°C, then dried at 80°C for 30 min before radioisotope exposure.
Northern probe sequences: tRNAS initiator methionine:
TGGTAGCAGAGGATGGTTTCGATCCATCGACCTCTGGGTTATGGGCCCAGCACGCTTCCGCT GCGCCACTCTGCT U2 snRNA: GAACAGATACTACACTTGATCTTAGCCAA
DNA probes (10 μM stock, 2 uL probe per reaction) were labeled with P32 using T4 PNK (ThermoFisher) and purified using Oligo Clean and Concentrator (Zymo Research). Labeled oligos were incubated with membrane at 42°C while rotating overnight. Membranes were washed 4 × 1 hr with pre-hybridization buffer at 42°C, then dried at 80°C for 30 min before radioisotope exposure.
Northern probe sequences: tRNAS initiator methionine:
5
Enrichment of ARG-seq and eRNA-seq Libraries
6
SARS-CoV-2 Probe Immobilization Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The forward primer was designed with a poly-15T at the 5′ end of the probe as a vertical spacer. 6-mercapto-1-hexanol (MCH, Sigma-Aldrich) is a commonly used, stable, and cost-effective lateral spacer. The MCH was optimized to be mixed with forward primers with a 1:10 ratio for surface immobilization (del Río et al., 2017 (link)). Reduction for oligos with thiol modification has followed the protocol provided by IDT. 1 μL of 10 μM thiolated forward primer for E gene or N gene with 100 μM MCH were prepared in 1M KH2PO4 (Sigma-Aldrich), and the mixtures were added into separate PDMS chambers for immobilization on the gold surface. The coating was carried out in a humid chamber at room temperature for 20 h. The gold surface was then washed to remove nonspecific immobilization of DNA by (1) rinsing in Milli-Q water for 5 min (2) drying in the stream of N2. (3) washing for 5 min in PBS, Tween 20, and Milli-Q. The surface was then blocked with Denhardt’s solution (ThermoFisher) at room temperature for 20 min to prevent nonspecific binding during subsequent steps. As a final step, the chamber was washed with PBS and Milli-Q water for 5 min and dried with the nitrogen stream.
7
Detecting Virulence Factors in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following probes were used in this study: astA, a 111-bp PCR product from EAEC 042 strain with the primer set EAST11a (5’-CCATCAACACAGTATTCCGA) and EAST12b (5’-GGTCGCGAGTGACGGCTTTGT)
[26 (link)]; and EAF, a 1.0 kb BamHI-SalI fragment from plasmid pMAR2
[27 (link)]. The DNA fragments were purified, labeled with [α-32P] dCTP with a DNA labeling kit (Amersham Pharmacia Biotech Inc., EUA) and used as probes. For Southern blotting, plasmid DNA was extracted using the method of Birnboim and Doly
[28 (link)], separated in 0.8% agarose gel electrophoresis, and transferred to a nylon membrane, following a standard protocol
[29 ]. Blots were hybridized in a solution containing the labeled probe (105 cpm), 5 × standard saline citrate (SSC), 2 × Denhardt’s solution (Invitrogen), 0.1% sodium dodecyl sulfate (SDS), and 5 mg/ml of salmon sperm DNA for 16 h at 65°C. After hybridization, washes were done in aqueous solution with 2 × SSC with 0.1% SDS and exposed to X-ray film.
[26 (link)]; and EAF, a 1.0 kb BamHI-SalI fragment from plasmid pMAR2
[27 (link)]. The DNA fragments were purified, labeled with [α-32P] dCTP with a DNA labeling kit (Amersham Pharmacia Biotech Inc., EUA) and used as probes. For Southern blotting, plasmid DNA was extracted using the method of Birnboim and Doly
[28 (link)], separated in 0.8% agarose gel electrophoresis, and transferred to a nylon membrane, following a standard protocol
[29 ]. Blots were hybridized in a solution containing the labeled probe (105 cpm), 5 × standard saline citrate (SSC), 2 × Denhardt’s solution (Invitrogen), 0.1% sodium dodecyl sulfate (SDS), and 5 mg/ml of salmon sperm DNA for 16 h at 65°C. After hybridization, washes were done in aqueous solution with 2 × SSC with 0.1% SDS and exposed to X-ray film.
8
Surface-based miRNA Detection Assay
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!