Mir 205 mimic

miR-205 mimics, control mimics, miR-205 locked nucleic acids (LNA), and control LNA were synthesized by Shanghai Genepharma Co. Ltd. (China). VEGF-A-specific short hairpin RNAs (shRNAs) were generated using oligonucleotide annealing and inserted into pSilencer 2.0 upon BamHI/HindIII restriction. The shRNA sequence was as follows: Forward, 5’-GATCCGCACAGACTCGCGTTGCAAGTTCAAGAGACTTGCAACGCGAGTCTGTGTTTTTTGGAAA-3’;Reverse,5’-AGCTTTTCCAAAAAACACAGACTCGCGTTGCAAGTCTCTTGAACTTGCAACGCGAGTCTG TGCG-3’. VEGF-A CDS and full-length VEGF-A with target 3’ UTR fragment were obtained from HEK293 cell cDNA library and constructed into pcDNA3.1 plasmid using BamHI/EcoRI restriction. The primers of VEGF-A CDS were as follows:

Forward, 5’-CGCGGATCCACCATGAACTTTCTGCTGTC-3’;

Reverse, 5’-CCGGAATTCTCACCGCCTCGGCTTGTCAC-3’.

The primers of full-length VEGF-A with target 3’ UTR were as follows:

Forward, 5’-CGCGGATCCACCATGAACTTTCTGCTGTC-3’;

Reverse, 5’-CCGGAATTCAGTGCTCTGCGCAGAGTCTC-3’. The oligonucleotide (1 to 180) of VEGF-A 3’ UTR was synthesized and inserted into pmirGLO luciferase plasmid using PmeI and XbaI restrictions.

Four human NB cell lines, SH-SY5Y (CRL-2266), SK-N-SH (HTB-11), IMR32 (CCL-127), and BE(2)-C (CRL-2268), and human umbilical vein endothelial cells (HUVECs; CRL-1730) were purchased from the American Type Culture Collection (Manassas, VA, USA). All cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Carlsbad, CA, USA) containing 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA), and 100 U/ml penicillin or 100 mg/ml streptomycin at 37°C in a humidified chamber supplemented with 5% CO₂.
An miR-205 mimic and a corresponding negative control (miR-NC) were purchased from GenePharma Co., Ltd. (Shanghai, P.R. China) and dissolved in diethylpyrocarbonate-treated water. The cAMP-responsive element-binding protein 1 (CREB1) overexpression plasmid (pCDNA3.1-CREB1) was provided by Dr. Jun Wang (Jilin University). Transfection was performed using Oligofectamine™ Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.

MiR-205 mimic and anti-miR-205 inhibitor were purchased from GenePharma (Shanghai, China). When CNE2 cells reached 70% confluence, they were transfected with MiR-205 mimic or anti-miR-205 inhibitor using Lipofectamine® 2000 (Invitrogen, USA) according to the manufacturer’s instructions. Scrambled oligonucleotide was used as negative control for the transfection.