The 1,330 bpZscan4c promoter was inserted into a pGL3 vector (Clontech). An expression plasmid (pCDNA3.1/FLAG) containing the full length of mouse Duxbl1 sequence was constructed. Dux-HA was a kind gift of dr. De Iaco. To assess Zscan4 activation state, HEK293T cells were transfected with Dux-HA alone and with increasing concentration of Duxbl1-FLAG together with pGL3-Basic vector (Clontech) in 60 mm plates. The RSV-β-galactosidase plasmid was added to transfection mixtures to normalize the luciferase values for the efficiency of transfection. Twenty-four hours after transfection, luciferase activity was determined using the Luciferase Assay System (Promega, Madison, WI, USA).
Pgl3 vector
Manufactured by Takara Bio
Sourced in Japan
The PGL3 vector is a plasmid designed for gene expression studies. It contains a strong promoter, a multiple cloning site for insertion of target genes, and a reporter gene for monitoring expression. The core function of the PGL3 vector is to enable the expression and analysis of target genes in various cell lines or experimental systems.
Automatically generated - may contain errors
Lab products found in correlation
Pgl3 vector, by Promega (2 mentions)
Pgl3 basic vector, by Takara Bio (1 mentions)
Luciferase assay system, by Promega (1 mentions)
Kod dna polymerase, by Toyobo (1 mentions)
Lipofectamine 2000, by Promega (1 mentions)
Mutanbest kit, by Takara Bio (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
4 protocols using pgl3 vector
1
Duxbl1 Regulation of Zscan4 Activation
2
Cloning and Modification of MYCT1 Promoter Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MYCT1 promoter (−925 bp/−145 bp) was cloned from HeLa genome by KOD DNA polymerase (TOYOBO, Osaka, Japan) and cloned into pGL3 vector (Clontech, Mountain View, CA, USA). Two primers contain KpnI and BglII restriction enzyme sites, respectively, and their sequences are as follows: primer −925: 5′‐TAGGTACC TATTTATGAAATGAATTAAATAACTTTC‐3′; and primer −145: 5′‐GCAGATCT AAAAGGAAATAAGTGTATCATGTTTCCT‐3′. For cloning of GFP‐fused truncation mutants, GFP sequence was cloned at the end of the truncation mutants by overlap PCR. Deletion mutations or point mutations were also constructed by overlap PCR. These sequences were all inserted into the BamHI/EcoRI site of pLVX‐Puro or pLVX‐flag‐Puro lentivirus plasmid vector (Clontech).
3
Cloning and Mutagenesis of PIK3CA 3' UTR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human PIK3CA 3′ UTR (GenBank accession NM_006218.3) containing the predicted miR-152-5p binding site was PCR amplified using genomic DNA from SGC-7901 cells. Then, the PCR product was cloned into the pGL3 Vector (Promega, Madison, WI, USA) located between XbaI and EcoRI restriction enzyme sites downstream of the firefly luciferase reporter gene and named PIK3CA-wt-3′ UTR. The miR-152-5p target binding site was muted using MutanBEST mutation kit (Takara, Japan), and also cloned into the pGL3 Vector, named PIK3CA-mut-3′ UTR. Primers for cloning (bold italic for restriction sites) are as follows:
PIK3CA wt-3'UTR Forward: 5′-CTAGTCTAGA CAGAGAACTGTGTTTTACCCG -3′. PIK3CA wt-3'UTR Reverse: 5′-CCGGAATTCC AGATCTTAGTCACCCATGTAG -3′.
PIK3CA mut-3'UTR Forward: 5′-TACATCCCCCCCTCATCCACACCAACCTCCACCATTAAAATGCACA -3′. PIK3CAMut-3'UTR Reverse: 5′-GTTGGTGTGGATGAGGGGGGGATGTAACTATCTGGACTGATAGATA -3′.
PIK3CA wt-3'UTR Forward: 5′-CTAG
PIK3CA mut-3'UTR Forward: 5′-TACATCCCCCCCTCATCCACACCAACCTCCACCATTAAAATGCACA -3′. PIK3CAMut-3'UTR Reverse: 5′-GTTGGTGTGGATGAGGGGGGGATGTAACTATCTGGACTGATAGATA -3′.
4
Luciferase Assay for miRNA Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human NUPR1L 3′ UTR (GenBank accession NM_001145712.2) and PFDN1 3′ UTR (GenBank accession NM_002622.5) containing the predicted miRNA binding sites were PCR amplified using genomic DNA from SW620 cells. The PCR product was then cloned into the pGL3 vector (Promega, Madison, WI, USA) located between XbaI and EcoRI restriction enzyme sites downstream of the firefly luciferase reporter gene. MutanBEST Kit (Takara, Japan) was used to mutate the target binding sites of miRNA and cloned into the pGL3 vector.
The firefly luciferase reporter plasmids containing wt or mutant 3'UTRs (100ng), the control renilla luciferase plasmid (pRL-CMV, 5ng) (Promega), and miRNA mimics were co-transfected into the cells using Lipofectamine2000 according to the manufacturer's protocol. After 48 hours, luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega).
The firefly luciferase reporter plasmids containing wt or mutant 3'UTRs (100ng), the control renilla luciferase plasmid (pRL-CMV, 5ng) (Promega), and miRNA mimics were co-transfected into the cells using Lipofectamine2000 according to the manufacturer's protocol. After 48 hours, luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!