E coli bl21 gold de3 competent cells

Manufactured by Agilent Technologies

E. coli BL21-GOLD (DE3) competent cells are a strain of Escherichia coli bacteria that have been genetically modified for use in recombinant protein expression. They are designed to provide high-level expression of recombinant proteins under the control of the T7 RNA polymerase promoter system.

Automatically generated - may contain errors

Lab products found in correlation

Sanger sequencing, by Genomed (1 mentions)

Spelling variants of this product

E. coli BL21-Gold (DE3) cells (19 citations) E. coli BL21-GOLD(DE3) (15 citations) E. coli BL21 (DE3) cells (12 citations) E. coli BL21 (DE3) (12 citations) BL21(DE3) competent cells (10 citations) BL21-Gold (DE3) Competent Cells (5 citations) E. coli BL21(DE3) competent cells (4 citations) E. coli BL21 Gold competent cells (3 citations) BL21-Gold(DE3) Competent E. coli (2 citations) BL21 Gold E. coli cells (2 citations)

3 protocols using e coli bl21 gold de3 competent cells

Constructing R33A Mutant of HasAp Truncated Gene

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pET11a vector harboring a truncated gene of HasAp missing the last 21 C-terminal residues^{15 (link)} was used to construct the R33A mutant. The primers, synthesized by Integrated DNA Technologies, Inc. (Coralville, IA), were used with the QuickChange site-directed mutagenesis kit (Stratagene; La Jolla, CA). Primers used to introduce the R33A mutation were 5′-TATTTTGGCGATGTGAACCATGCGCCGGGCCAGGT-GGTGGATGGC-3′ and 5′-GCCATCCACCACCTGGCCCGGCGCATGGTTCACATCGCC-AAAATA-3′, where the underlined codons represent target substitutions. The recombinant gene harboring the mutation was transformed into XL1-Blue Competent cells (Stratagene) for amplification, and the DNA sequence verified by ACGT Inc. (Wheeling, IL). The recombinant DNA plasmid with the correct sequence was transformed into E. coli BL21-GOLD (DE3) competent cells (Agilent Technologies, CA) for subsequent protein expression. The protocols for protein expression, purification of the apo-proteins and reconstitution with heme, have been described previously.^{14 (link)}

Kumar R., Qi Y., Matsumura H., Lovell S., Yao H., Battaile K.P., Im W., Moënne-Loccoz P, & Rivera M. (2016). Replacing Arginine 33 for Alanine in the Hemophore HasA from Pseudomonas aeruginosa Causes Closure of the H32 Loop in the Apo-Protein. Biochemistry, 55(18), 2622-2631.

+ Open protocol

+ Expand

Site-Directed Mutagenesis of ReAIV and ReAV

Check if the same lab product or an alternative is used in the 5 most similar protocols

Site-directed mutagenesis of ReAIV and ReAV was carried out using the polymerase incomplete primer extension (PIPE) technique (Klock and Lesley, 2009 (link)). The lysine codons were changed to alanine at position 137 (ReAIV) or 138 (ReAV). The pET151D-ReAIV or pET151D-ReAV plasmids carrying the original protein sequences were used as templates for PCR amplification. To eliminate transformation background, template DNA was digested by DpnI restriction enzyme according to the manufacturer’s protocol. The reaction products were used for transformation of E. coli BL21 Gold (DE3) competent cells (Agilent Technologies). The mutations (underlined codons) were introduced using specific primers, as listed below:
ReAV-K138A_FWD: TGCTCGGGCGCGCACGTCGGCATGCTTGCC
ReAV-K138A_REV: CCGACGTGCGCGCCCGAGCAATTGCTGCAAACC.
ReAIV_K137A_FWD: TGTAGCGGTGCACATGCCGGTTTTATTTGTGCATGTTGC.
ReAIV_K137A_REV: CCGGCATGTGCACCGCTACAGTTATTATGCAGTGCG.
All resulting vectors were verified by DNA sequencing and the mutated proteins were overexpressed and purified as described for the WT proteins.

Sliwiak J., Worsztynowicz P., Pokrywka K., Loch J.I., Grzechowiak M, & Jaskolski M. (2024). Biochemical characterization of L-asparaginase isoforms from Rhizobium etli—the boosting effect of zinc. Frontiers in Chemistry, 12, 1373312.

+ Open protocol

+ Expand

Site-Directed Mutagenesis of ReAV

Check if the same lab product or an alternative is used in the 5 most similar protocols

Site-directed mutagenesis of ReAV was performed using the polymerase incomplete primer extension (PIPE) technique (Klock and Lesley, 2009 (link)) (K138A, C189A, C249A) or according to Q5-site mutagenesis protocol (C135A, H139A, Y156A, D187A) to introduce alanine substitutions at designated positions. The mutations were introduced using specific primers, as listed in Table 1. The pET151-D-ReAV plasmid carrying the original protein sequence was used as template for PCR amplification. To eliminate transformation background, template DNA was digested with DpnI restriction enzyme according to the manufacturer’s protocol. The reaction products were used for transformation of E. coli BL21-Gold (DE3) competent cells (Agilent Technologies). After overnight incubation on LB agar plates supplemented with 100 μg∙mL⁻¹ ampicillin, single colonies were inoculated into 4 mL of LB medium containing ampicillin, and grown overnight at 37°C. Following overnight incubation, plasmids were isolated and sequenced to confirm the presence of the desired mutations by Sanger sequencing (Genomed, Poland).

Pokrywka K., Grzechowiak M., Sliwiak J., Worsztynowicz P., Loch J.I., Ruszkowski M., Gilski M, & Jaskolski M. (2024). Probing the active site of Class 3 L-asparaginase by mutagenesis. I. Tinkering with the zinc coordination site of ReAV. Frontiers in Chemistry, 12, 1381032.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!