Log In Sign up
The largest database of trusted experimental protocols

Primescript reverse transcriptase reagent kit

Manufactured by Vazyme
Visit Supplier
Sourced in China

The PrimeScript reverse transcriptase reagent kit is a laboratory tool designed for the reverse transcription of RNA to cDNA. It contains the necessary components, including the PrimeScript reverse transcriptase enzyme, to facilitate this fundamental molecular biology procedure.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent kit, by Takara Bio (3 mentions) Sybr premix ex taq kit, by Vazyme (2 mentions) Cfx96 touch real time system, by Bio-Rad (1 mentions) Cfx96 touchtm real time system, by Bio-Rad (1 mentions) Trizol, by Takara Bio (1 mentions) Abi quantstudio 5 real time system, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Trypsin, by Avantor (1 mentions) Charcoal treated fbs, by Sartorius (1 mentions) Collagenase 1, by Thermo Fisher Scientific (1 mentions) Dmem f12, by Merck Group (1 mentions) Dispase, by Roche (1 mentions) Cfx96 touch real time system thermocycler, by Bio-Rad (1 mentions)

5 protocols using primescript reverse transcriptase reagent kit

1

Quantitative RT-PCR gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were isolated with TRIzol reagent kit (T9109, TaKaRa) and reverse transcribed with PrimeScript reverse transcriptase reagent kit (R233, Vazyme, Nanjing, China) according to the manufacturer’s instructions. RT-qPCR was performed using SYBR (Q311, Vazyme, Nanjing, China) on a Bio-Rad CFX96 Touch™ Real-Time System thermocycler using gene-specific primers. Gene expression was analyzed after Ct values were normalized to the Rpl7 housekeeping gene. Primers used in this study was listed in Table 1.
Li Y., Chen S.T., He Y.Y., Li B., Yang C., Yang Z.S, & Yang Z.M. (2023). The regulation and function of acetylated high-mobility group box 1 during implantation and decidualization. Frontiers in Immunology, 14, 1024706.
+ Open protocol
+ Expand
2

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were extracted from the whole uteri or cultured cells using TRIZOL (TaKaRa, Japan) method, and cDNAs were reverse-transcribed by PrimeScript reverse transcriptase reagent kit (Vazyme, China) according to the manufacturer’s introduction. qPCR was performed using an SYBR Premix Ex Taq kit (Vazyme, China) on the CFX96 TouchTM Real-Time System (BioRad, United Sates). Data were analyzed and normalized to RPL7 for human data and Rpl7 for mouse data. The corresponding primer sequences of each gene used in this study were listed in Table 2.
Zhu Y.Y., Wu Y., Chen S.T., Kang J.W., Pan J.M., Liu X.Z., Li S.Y., Yan G.J., Liu A.X., Huang Q.T., Yang Z.M, & Su R.W. (2021). In situ Synthesized Monosodium Urate Crystal Enhances Endometrium Decidualization via Sterile Inflammation During Pregnancy. Frontiers in Cell and Developmental Biology, 9, 702590.
+ Open protocol
+ Expand
3

Real-time PCR Analysis of Antioxidant Gene Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Real-time PCR was performed as previously described
[27] (link). Briefly, total RNA was isolated from E10.5 embryos using TRIzol reagent (15596026; Invitrogen, Carlsbad, USA). A PrimeScript reverse transcriptase reagent kit (R223-01; Vazyme, Nanjing, China) was used to reverse-transcribe RNA into cDNA. Real-time PCR was performed by using a SYBR Premix Ex Taq kit (Q711-02; Vazyme) on the ABI QuantStudio 5 Real-Time System (Applied Biosystems, Foster City, USA). The reaction conditions were as following: 95°C for 30 s; 95°C for 10 s, 60°C for 30 s, 40 cycles; and then the default melting curve acquisition program. Data were normalized against the level of
Rpl7 expression. The sequences of primers used in this study are listed in
Table 1.

Table 1 Sequences of primers for real-time qPCR

Gene

Forward primer (5′→3′)

Reverse primer (5′→3′)

Size (bp)

Accession No.

Gpx1

GTCCACCGTGTATGCCTTCT

TCTGCAGATCGTTCATCTCG

152

NM_008160.6

Sod1

CCAGTGCAGGACCTCATTTT

TTGTTTCTCATGGACCACCA

197

NM_011434.2

Sod2

CCGAGGAGAAGTACCACGAG

GCTTGATAGCCTCCAGCAAC

174

NM_013671.3

Rpl7

GCAGATGTACCGCACTGAGATTC

ACCTTTGGGCTTACTCCATTGATA

129

NM_011291.5

Liang Y., Wang Y., Zhang X., Jin S., Guo Y., Yu Z., Xu X., Shuai Q., Feng Z., Chen B., Liang T., Ao R., Li J., Zhang J., Cao R., Zhao H., Chen Z., Liu Z, & Xie J. (2023). Melatonin alleviates valproic acid-induced neural tube defects by modulating Src/PI3K/ERK signaling and oxidative stress: Melatonin alleviates VPA-induced neural tube defects. Acta Biochimica et Biophysica Sinica, 56(1), 23-33.
+ Open protocol
+ Expand
4

Isolation and Decidualization of Mouse Uterine Stromal Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were isolated with TRIzol reagent kit (T9109, TaKaRa) and reverse transcribed with PrimeScript reverse transcriptase reagent kit (R233, Vazyme, Nanjing, China) according to the manufacturer's instructions. XBP1 primers were designed to contain the 26 base pair fragment for analysis of spliced and unspliced XBP1 mRNA. Products were separated on 2.5% agarose gel. The primer sequences were described in Table S1 Isolation and culture of mouse uterine stromal cells Stromal cells were isolated from mouse uteri. In brief, mouse uteri on day 4 of pregnancy were digested with 1% trypsin (0458, AMRESCO) and 6 mg/ml dispase (0494207801, Roche) in Hanks' balanced salt solution (H4891, Sigma). After luminal epithelial cells were removed by washing, the remaining uteri were incubated with 0.15 mg/ml collagenase I (17100017, Gibco). The isolated stromal cells were cultured in DMEM/F12 (D2906, Sigma) containing 10% charcoal-treated FBS (Biological Industries, Israel).
In vitro decidualization of endometrial stromal cells were induced with 1 mM progesterone and 10 nM 17β-estradiol as described [16] .
Chen Y., Li Y., Pan H., Li M., Pan J., Chen S., Zhang H., Yang Z., Dou H., & Yang Z. (2021). Female Reproductive Failures in Mouse Adolescent Pregnancy.
+ Open protocol
+ Expand
5

RNA Isolation and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNAs were isolated with TRIzol reagent kit (T9109, TaKaRa) and reverse transcribed with PrimeScript reverse transcriptase reagent kit (R233, Vazyme, Nanjing, China) according to the manufacturer's instructions. RT-qPCR was performed using SYBR (Q311, Vazyme, Nanjing, China) on a Bio-Rad CFX96 Touch™ Real-Time System thermocycler using gene-speci c primers (Table S1). Gene expression was analyzed, and the Ct values were normalized to Rpl7 housekeeping gene.
Chen Y., Li Y., Pan H., Li M., Pan J., Chen S., Zhang H., Yang Z., Dou H., & Yang Z. (2021). Female Reproductive Failures in Mouse Adolescent Pregnancy.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!