Zebrafish fscn1a and mouse fscn1 were cloned into pcs2-Flag and pcs2-Myc vectors for eukaryotic expression. The plasmids pcs2-Myc-fscn1 S39A and S39D were constructed by the mutagenesis of pcs2-Myc-fscn1 using the Fast Mutagenesis System (FM111, TransGen Biotech) and confirmed by DNA sequencing. Rab5-GFP plasmid was bought from Origene. DynaminK44A plasmid was kindly gifted from Professor Ye-Guang Chen of Tsinghua University (Beijing, China). Professor. Xiaohong Fang of Institute of Chemistry, Chinese Academy of Sciences (Beijing, China) kindly provided the Clathrin-mRFP plasmid. For testing the effectiveness of fscn1a MO1 and MO2, the expression vector fscn1a-GFP was generated by fusing the 71 bp upstream flanking region and the first 276 bp of the fscn1a open reading frame into a pEGFP-N3 vector. For RNA interference, two fscn1 shRNA constructs were generated using a pll3.7 plasmid. The targeted sequences were as follows: 5′- AACTCTTCCTCATGAAGC -3′ and 5′- AGGCTGTGCAGATTCAGT -3′.
Fast mutagenesis system fm111
Manufactured by Transgene
The Fast Mutagenesis System (FM111) is a laboratory equipment designed for rapid DNA modification. It enables efficient and targeted mutagenesis of genetic sequences. The core function of the system is to facilitate the introduction of specific changes or mutations into DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using fast mutagenesis system fm111
1
Molecular Cloning and Manipulation of fscn1 Genes
2
Genetic Engineering of CRC Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For PHLDB2-Flag-tagged constructs, PHLDB2 complementary DNA (cDNA) was inserted into the pcDNA3.1 vector (Addgene) with 3× Flag at the C-terminus. For EGFR–GFP–tagged constructs, EGFR cDNA was inserted into a modified pcDNA3.1 vector containing GFP tags. For Ubiquitin (UB)-Hemagglutinin (HA)-tagged constructs, UB cDNA was inserted into modified pcDNA3.1 vector containing HA tags. Single-point and truncated mutants were generated by the Fast Mutagenesis System (FM111; Transgene, Beijing, China). For the generation of PHLDB2-overexpressed or PHLDB2-silenced CRC cells, HEK293T cells were co-transfected with pSPAX2, pMD2.G, and pCDH-CMV-MCS-EF1-Puro-PHLDB2, or shPHLDB2, or control pCDH-CMV-MCS-EF1-Puro plasmid, or control shRNA pLKO.1 plasmid. At 48 hours after transfection, lentivirus-containing medium was collected, filtered (0.45-μm filter), and supplemented with 8 mg/mL Polybrene (Sigma-Aldrich). CRC cells subsequently were transduced and selected with 2 μg/mL puromycin (540411; Calbiochem, San Diego, CA) for 2 weeks. The primer sequences are listed as follows: shPHLDB2 1: CCGGCCCTGTAGTGATGTAAGACTACTCGAGTAGTCTTACATCACTACAGGGTTTTTTG; and shPHLDB2 2: CCGGGCAGACGGCAATAATCTCTTACTCGAGTAAGAGATTATTGCCGTCTGCTTTTTTG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!