Cfx96 touch real time fluorescence quantitative pcr instrument

Total RNA was isolated from the cells and tissues using the TRIzol reagent (Takara). RNA was reverse-transcribed to cDNA through the PrimeScript™ RT reagent Kit (Takara). Amplification was performed on a CFX96 Touch Real-Time Fluorescence Quantitative PCR Instrument (Bio-Rad Laboratories) using TaKaRa TB Green^™ Premix Ex Taq^™ II (Takara). GAPDH was used as a loading control. The 2^−ΔΔCt method was used to quantify targeted mRNA expression. Three independent replicates were analyzed. The primer sequences used in this study are listed in Additional file 5: Table S2.

Total RNA was extracted from PC cells and tissues using TRIzol reagent (Takara). To determine mRNA and circRNA expression, cDNA was reverse transcribed using the iSCRIPT cDNA synthesis Kit (Roche® Life Science), while the miRNA First Strand cDNA Synthesis Kit (Sangon) was used to reverse transcribe miRNA as cDNA. Amplification was performed on a CFX96 Touch Real-Time Fluorescence Quantitative PCR Instrument (Bio-Rad Laboratories) using TB Green® Fast qPCR Mix (Takara). GAPDH (mRNA and circRNA) and U6 (miRNA) were used as loading controls. The results were analyzed using the 2 ^-ΔΔCt method. The primer sequences used in the present study were as follows:
circATG7 Forward primer (5′ to 3′): CTCCTCTTGACATTTGCAGAGTG,
circATG7 Reverse primer (5′ to 3′): GCAGTCTTGAAAGACTCGAGTGTG;
miR-766-5p Forward primer (5′ to 3′): TCGAGTACTTGAGATGGAGTTTT,
miR-766-5p Reverse primer (5′ to 3′): GGCCGCGTTGCAGTGAGCCGAG;
ATG7 Forward primer (5′ to 3′): CAGTTTGCCCCTTTTAGTAGTGC,
ATG7 Reverse primer (5′ to 3′): CCAGCCGATACTCGTTCAGC;
U6 Forward primer (5′ to 3′): CTCGCTTCGGCAGCACA,
U6 Reverse primer (5′ to 3′): AACGCTTCACGAATTTGCGT;
GAPDH Forward primer (5′ to 3′): CTCCAAAATCAAGTGGGGCG,
GAPDH Reverse primer (5′ to 3′): TGGTTCACACCCATGACGAA.