Epitect bisulfite kit

We used leaf tissue as starting material for BS-seq libraries preparation. Genomic DNA was extracted and converted with bisulfite treatment with EpiTect Bisulfite Kit (Qiagen), following the manufacturer’s instructions. We sonicated genomic DNA from samples, end-repaired, and ligated with TruSeq DNA single adapters (Illumina) using a Kapa DNA HyperPrep kit (Roche) and converted with an EpiTect Bisulfite Kit (Qiagen). Converted DNA was PCR-amplified by MyTaq polymerase (Bioline) for 12 cycles. The libraries were run on D1000 ScreenTape (Agilent) to determine the quality and size and then purified by AMPure XP beads (Beckman Coulter).

For the preparation of WGBS libraries, genomic DNA was first extracted from leaves and inflorescence tissue (for Ler samples) using the DNeasy Plant Mini Kit (Qiagen). 100 ng of DNA was then used for subsequent shearing using a Covaris S2 Focused Ultrasonicator. Libraries were then prepared using either the Ovation Ultralow Methyl-Seq kit (NuGen) in conjuction with the EpiTect Bisulfite Kit (Qiagen), or the Hyper Prep Kit (KAPA Biosystems) in conjuction with either the EZ DNA Methylation-Lightning Kit (Zymo) or the EpiTect Bisulfite Kit (Qiagen). Single-end 50 bp reads were then uniquely aligned to the TAIR10 genome using BS-Seeker2^{58 (link)}. Methylation levels were then calculated for the CG, CHG, and CHH contexts. A filter was implemented to remove reads with three or more consecutively methylated cytosines in the CHH context, as previously described^{59 (link)}. Metaplots of BS-seq data were generated with custom Python and R scripts. For methylation calculations over individual chromosomes, each chromosome was split into 100 kb bins. Methylation values were then calculated from these bins.

DNA was extracted from hippocampal tissue samples using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, and sodium bisulfite modification was performed using the Qiagen EpiTect Bisulfite Kit (Qiagen). Primers (forward: TTTTAATTAGGGATTTTTAAGAGGTTAGGT; reverse: CCACAAATACCAACCCTTAACACTTCTAAT) for amplifying the bisulfite-converted DNA sequences were designed using PyroMark Assay Design v2.0 software (Qiagen). PCR amplification was performed on an ABI 9700 PCR system (Applied Biosystems, Foster City, CA, United States). Pyrosequencing and analysis of DNA methylation status of all CpG sites were performed using PyroMark Q96 ID (Qiagen).

After sevoflurane anesthesia, L3–L5 DRGs were harvested 7 days after CCI or sham surgery. DRGs from 6 mice and spinal cord from 3 mice, were separately pooled for DNA extraction (Qiagen, Hilden, Germany; Cat No: 69506). Methylation treatment of genomic DNA was carried out using a QiagenEpiTect Bisulfite Kit (Qiagen, Cat No: 59104) in accordance with the manufacturer’s instructions. A region of the Oprm1 gene promoter from –85 to +634 bp, which consists of 17 CpG sites, was divided into eight regions and amplified. For the pyrosequencing assay, after amplifying the bisulfite DNA with eight pairs of primers of the Oprm1 gene (Supplementary Table 2), binding buffer, streptavidin-sepharose beads, and PCR products were prepared for the binding reaction. The plate was then placed on a shaker for at least 15 min, but no longer than 1 h. Pyrosequencing was then performed. For the clone-sequencing assay, the same promoter fragment was amplified. PCR products were transformed into competent cells. Finally, PCR amplification and direct sequencing were carried on after an overnight bacterial culture (Taylor et al., 2007 (link); Tost and Gut, 2007 (link)).

Genomic DNA was extracted from the hippocampus CA1 region tissue collected, using the Genomic DNA extraction kit (Qiagen DNeasy kit, 69506, Hilden, Germany) was used to extract DNA, the QiagenEpiTect Bisulfite Kit (Qiagen, 59104, Hilden, Germany) was used for bisulfite conversion. Polymerase chain reaction (PCR) primers and pyrosequencing primers (Table 2) were designed using PyroMark Assay Design 2.0 software (Qiagen, Valencia, CA, USA) to target six CpG sites in the promoter region and 12 CpG sites in the exon-1 region of the PDE4D gene. The promoter region was defined as the gene region directly upstream 2 kbp range of the transcription start site (TSS). PCR reactions were performed with KAPA DNA polymerase reagents (Kapa Biosystems, kk2101, USA). PCR was performed under the following conditions: 95 °C, 3 min; 94 °C, 30 s; 40 cycles of 56 °C, 30 s; 72 °C, 1 min; 72 °C, 7 min; and 4 °C hold. The PCR product was sequenced using PyroMark Q96 (Qiagen, PyroMark Q96 ID, Valencia, CA, USA) Pyro sequencer. Epi-Tect high and low methylated control DNA (Qiagen Sciences, Germantown, MD, USA) were included with every pyrosequencing experiment.

We tested the performance of a risk score, called the S5 classifier, at detecting pre‐cancerous (CIN2 n = 41 and CIN3 n = 105) and cancerous (n = 3) cervical intraepithelial neoplasia (CIN2+) on formalin‐fixed paraffin‐embedded (FFPE) biopsies collected at colposcopy. The results were compared to those obtained from a set of paired exfoliated cell samples (reference standard) from the same women. We tested four different bisulfite conversion kits: The Zymo EZ DNA Methylation kit (EZ Std) which was the kit used to develop the S5 classifier, the Zymo EZ DNA Methylation‐Lightning (EZ Lightning), the Qiagen Epitect Bisulfite Kit (Epitect Std), and the Qiagen Epitect Fast Bisulfite Kit (Epitect Fast).