Resuspension buffer r

Gli1 gene silencing on K-562 cells was performed by inserting into cells a siRNA (AUAUCUUGCCCGAAGCAGGUAGUGC) towards Gli1 or a control scrambled siRNA owning the same CG ratio, at a final concentration of 30 nM by means of electroporation. Briefly, cells were centrifuged at 200g for 10 min. at room temperature, washed with sterile PBS and centrifuged again. Then, cells were resuspended in resuspension buffer R (Invitrogen, Carlsbad, USA) at a final density of 1 x 10⁷ cells/ml and siRNA towards Gli1 (or scrambled siRNA) was added at a final concentration of 30 nM. Then cells were electroporated using Neon^™ Trasfection System (Invitrogen, Carlsbad, USA) and according to the following parameters: Pulse Voltage: 1350 v; Pulse Width: 10 ms; Pulse Number: 4; Cell Density: 3 x 10⁷. After electroporation, cells were plated on a 24-well plate at a concentration of 3 x 10⁵ cells/well in a final volume of 500 μL RPMI supplemented with 1% glutamine without antibiotics and with 10% FCS and incubated for 24 h in a humidified atmosphere at 37°C, 5% CO₂ for further analysis.

Approximately 5 × 10⁵Rex1-EGFP REFs were resuspended in Resuspension Buffer R (Invitrogen) and transfected with 1.5 μg of pPBTRE-hOSMK + 0.5 μg of PBase + 0.5μg of PB-rTTA (Gao et al., 2019 (link)), using the Neon transfection system (Invitrogen) set at 1350 V, 30 ms, 1 pulse. Transfected cells were plated in a 6-well plate at a density of 2.4 × 10³/cm² on γ-irradiated (100 Gy) STO mouse fibroblasts in M15G+SB medium (GMEM base media + 15% fetal bovine serum + 1000 U/mL human LIF + 50 μg/mL Vc + 1 μg/mL doxycycline + 1 mM sodium butyrate) and kept at 37°C in 5% CO₂. The medium was changed the day after transfection and every 2 days thereafter. Colonies emerged by day 10 and M15G+SB media changed to t2i+Lif (N2B27 medium, 1 mM PD0325901, 1 mM CHIR99021, 1000 U/mL mouse LIF). The colonies were fixed for immunocytochemistry at day 14.

C2C12 myoblasts were transfected with mirVana miRNA mimics and inhibitors (Invitrogen, Waltham, MA, USA) of mmu-miR-378a-3p (ACU GGA CUU GGA GUC AGA AGG), and mirVana miRNA Mimic Negative Control #1 (Invitrogen, Waltham, MA, USA) and mirVana miRNA Inhibitor Negative Control #1 (Invitrogen, Waltham, MA, USA) were used as the respective negative controls. Cells were transfected with the Neon Electroporation System (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. Briefly, after detachment with TrypLE Express, cells were washed with phosphate-buffered saline (PBS) 1X. The cells (1 × 10⁵) were resuspended in 10 μL of Resuspension Buffer R (Invitrogen, Waltham, MA, USA) and the miRNA sequence (25 μM) was added in order to reach a final concentration of 15 nM. A Neon Pipette (Invitrogen, Waltham, MA, USA) coupled to a 10 μL Neon Tip (Invitrogen, Waltham, MA, USA) was used to pipette the cell-miRNA mix that was submitted to 1 pulse of 1350 V with a width of 30 ms. After electroporation, cells were transferred to multi-well plates containing pre-warmed antibiotic-free media. After 24 h, the transfection efficiency was evaluated by RT-qPCR.