Grna cloning vector

For CRISPR-Cas9 genome editing a pCas9-GFP vector (hCas9, 9553 bp, plasmid 44719) and an empty sgRNA vector (gRNA_Cloning Vector, 3915 bp, plasmid 41824) were obtained from Addgene (Cambridge, MA, USA). Two sgRNAs for deletion of the Smurf1 gene were designed using CRISPR DESIGN (http://crispr.mit.edu/), and each sgRNA was cloned into the sgRNA vector using the protocol developed by Mali et al.^{67 (link)}. Shortly, the sgRNAs were synthesized as 60-mer oligonucleotides (Suppl. Table 2) (Integrated DNA technologies, Coralville, IA). Double stranded 100 bp DNA fragments were generated using a Phusion® High-Fidelity DNA Polymerase kit [1 rxn: 10 μl Phusion reaction buffer (HF), 2.5 μl dNTP (10 mM), 2 μl Smurf1_gRNA#1 F, and 2 μl Smurf1_gRNA#1 R, 2 μl Phusion DNA Polymerase, 31.5 μl ddH₂O]. The double stranded fragment was ligated into the sgRNA empty vector using the Gibson Assembly® Master Mix [5 μl (2×) Gibson assembly mix, 2 μl gRNA empty vector (linearized by AflII), 1 μl 100 bp PCR fragment, 2 μl ddH₂O] and incubated at 50 °C (60 min). For overexpression of Smurf1, full length Smurf1 mouse cDNA cloned into pCMV-SPORT6 and was purchased from ImaGenes GmbH (now Source Bioscience, Nottingham, UK). An empty pCMV-SPORT6 vector was used for mock transfection. For transfection of RPE cells SMURF1 siRNA was obtained from Ambion (ID: s32796) (ThermoFisher Scientific).

The HOIP-deficient RNF31-KO Jurkat cells were constructed as described previously (39 (link)). The gRNA_cloning vector (#41824) and pCAG-hCas9 (#51142) were obtained from Addgene. The nucleotide sequences 5’- AACAAGAATTGTAATGACCC -3’ in exon 9 of the human CYLD gene, and 5’- ATTAAGCGTAGCTCCTGAAA -3’ in exon 3 of the human OTULIN gene, were selected as the targets for the gRNA. These plasmids and a puromycin-resistant vector (pXS-Puro) were co-electroporated into Jurkat cells. Two days after transfection, cells were selected with puromycin for 3 weeks, and then cell clones were obtained by limiting dilution. The deficiency of the CYLD or OTULIN protein was confirmed by immunoblotting, and the nucleotide mutations were confirmed by sequencing.

Cas9 and gRNA_Cloning vector used for the nucleofection experiments were purchased from Addgene (plasmids #41815 and #41824).³⁵ (link) The gRNA_Cloning vector was optimized for gRNA cloning and expression by inserting the partially missing U6 promoter and gRNA scaffold sequences into the SpeI and NdeI sites of the gRNA_Cloning vector.³⁵ (link) The EGFP-targeting sgRNAs obtained by annealing the BH001–BH004 and BH037–BH044 oligonucleotides (Table S1) were cloned into the modified gRNA_Cloning vector using the Golden Gate Protocol.³⁶ (link)
The dicistronic BFP/EGFP and BFP/CYBB lentiviral vectors were generated by first inserting EGFP- and CYBB cDNAs into MscI and SbfI sites of the TagBFP-expressing lentiviral vector -pHR’SINcPPT-SBW obtained from M. Grez.³⁷ (link) Subsequently, an ECMV-IRES was cloned into the MscI site between the BFP/EGFP or BFP/CYBB cDNAs.
EGFP mutations were introduced by inserting annealed synthetic oligonucleotides into the BstXI sites of EGFP (Oligos SFHR037, SFHR038, and SFHR046–SFHR055). CYBB mutations were introduced by standard site-specific mutagenesis using the BH137–BH144 primers (Table S1).
pLentiCRISPRv2 vectors containing the different sgRNAs were obtained by target-specific oligonucleotide annealing (Table S1) using the GoldenGate protocol.

“hCas9” and “gRNA_Cloning Vector” were purchased from Addgene (plasmid #41815 and #41824 respectively). A sgRNA-expressing plasmid for PKR (“pCR sgPKR-1a”) was a kind gift from Dr. Stacy Horner at Duke University. sgRNA-expressing plasmids for nc886 were constructed according to the gDNA synthesis protocol (https://www.addgene.org/41824/ and [30 (link)]). Briefly, inserts were made by annealing two partially complementary oligos containing sgRNA sequences (shown in Supplementary Figure S5A) and converting into a fully double-stranded DNA fragment by Phusion™ High-Fidelity DNA Polymerase (New England Biolabs; Ipswich, MA, USA). The inserts were incorporated into AflII-linearized “gRNA_Cloning Vector” by using the Gibson assembly kit (New England Biolabs), to yield “pCR sg886-164” and “pCR sg886+15”.
The Cas9-expressing plasmid (“hCas9”), in combination with “pCR sgPKR-1a” (for PKR KO) or with “pCR sg886-164” and “pCR sg886+15” (for nc886 KO), was transfected by using Lipofectamine 2000 (Life Technologies). Untransfected cells were processed in parallel as a negative control during G418 selection. At 24 hrs after transfection, cells were transferred to a growth medium containing 1 mg/ml of G418. G418-resistant colonies were individually isolated and further cultured.

The PB CMV-BE3 EF1α-mCherry-T2A-puro sgRNA (Supplementary Note) was constructed by PCR assembly of the U6-sgRNA expression cassette from the gRNA_Cloning Vector (Addgene plasmid #41824, Addgene, USA), whereas CMV-BE3 was constructed from pCMV-BE3 (Addgene plasmid #73021), the puromycin gene from lentiGuide-Puro (Addgene plasmid #52963), and mCherry from PB_tet_attB-mCherry (a gift from Seung Hyeok Seok in Seoul National University College of Medicine) on a PiggyBac transposon backbone from PB-CA (Addgene plasmid #20960). The targeting sgRNA sequences were cloned according to the provided hCRISPR gRNA synthesis protocol. The pCy43 PiggyBac Transposase vector was provided by the Sanger Institute (Hinxton, UK). All cloned plasmids were confirmed by Sanger sequencing. Plasmids were prepared using the EndoFree Plasmid Maxi Kit (QIAGEN, USA) and Exprep Plasmid SV kit (GeneAll, Korea) according to manufacturers’ protocols.

RNA-guided DNA endonuclease was performed to edit genes through co-expression of the Cas9 protein (Addgene plasmid 41815) with gRNAs (http://www.addgene.org/crispr/church/). The targeting sequence (5′-GCGGCGCGCCACCCGCAGCG-3′) for lamin A/C was cloned into the gRNA cloning vector (Addgene plasmid 41824) via the Gibson assembly method (New England Biolabs). Lamin A/C-knockout HeLa cells were obtained through clonal propagation from a single cell. For genotyping, the following PCR primers were used: 5′-CGCACCTACACCAGCCAA-3′ and 5′-CGAACTCACCGCGCTTTC-3′. The PCR products were cloned and sequenced.

SET7/9 knockout (KO) HeLa cells were generated using CRISPR/Cas9 system as described previously53 (link). gRNA targeting sequence (5′-TAGCGACGACGAGATGGTGG-3′) was cloned into gRNA cloning vector (Addgene, 41824) and confirmed by sequencing. To screen for SET7/9 KO clones, HeLa cells were transfected with pcDNA3.3-hCas9 and gRNA expression vectors (Addgene 41815), followed by G418 selection (0.5 mg/ml). Single colonies were subjected to immunoblotting (IB) using anti-SET7/9 antibody to select knock-out ones, which were further validated by PCR using genomic DNA as template followed by Sanger sequencing. The sequencing information for primer sets used was as follows: Forward (F) 5′-CTCCTCCTCCTCCAAACTCG-3′; Reverse (R) 5′-ACTCCTTCCGCGCTCCAG-3′.