Log In Sign up
The largest database of trusted experimental protocols

Mmachine sp6 transcription kit

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The MMachine SP6 Transcription Kit is a reagent system designed for in vitro transcription of RNA. The kit includes the necessary components, such as RNA polymerase, nucleotides, and buffer, to facilitate the synthesis of RNA from a DNA template.

Automatically generated - may contain errors

Lab products found in correlation

Axiocam mrc, by Zeiss (2 mentions) Phenol red, by Merck Group (2 mentions) Rhodamine dextran, by Merck Group (2 mentions) Dnase treatment, by Qiagen (1 mentions) Bm purple, by Roche (1 mentions) Stereo discovery, by Zeiss (1 mentions) Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Dual luciferase assay system, by Promega (1 mentions) Maxiscript t7 kit, by Thermo Fisher Scientific (1 mentions)

7 protocols using mmachine sp6 transcription kit

1

Capped mRNA Microinjection for Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols
Capped messenger RNAs encoding the dominant negative NF-YA (NF-YA DN;
[32 (link)]), dominant negative Pbx4
(PBCAB; [33 (link)]) proteins were generated
from 2μg of Notl-digested linearized pCS2+ plasmids using the
mMessage mMachine SP6 Transcription Kit (ThermoFisher Scientific) according
to the manufacturer’s guidelines. The RNA was purified using the
RNeasy column with DNase treatment (Qiagen) according to the
manufacturer’s guidelines. RNA quality was assessed on a 1% agarose
gel and its concentration was measured on a NanoDrop instrument. 300pg of
RNA injection mix containing water and 0.1% phenol red was injected into
zebrafish embryos at the 1-cell stage. Injected embryos were raised to the
proper stage according to animal care guidelines.
Stanney W I.I.I., Ladam F., Donaldson I.J., Parsons T.J., Maehr R., Bobola N, & Sagerström C.G. (2019). Combinatorial action of NF-Y and TALE at embryonic enhancers defines distinct gene expression programs during zygotic genome activation in zebrafish. Developmental biology, 459(2), 161-180.
+ Open protocol
+ Expand
2

Whole-Mount in situ Hybridization for Xenopus Nrf2

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Nrf2 sequences were retrieved from the NCBI and Xenbase (http://www.xenbase.org, accessed on 9 February 2022) databases. Following PCR amplification, fragments of Nrf2 were cloned into the PCS107 plasmid. The plasmids were then linearized using BamHI and the mMACHINE SP6 Transcription Kit (Thermo Fisher, Waltham, MA, USA) was used to synthesize the DIG-labeled antisense fragment. Three normal live embryos in the control and 25 μmol/L groups were randomly selected from each dish for WISH at stages 19, 32, and 38 (nine samples per treatment group per stage). Then, the embryos were fixed in MEMFA (0.1 mol/L MOPS, 2 mmol/L EGTA, 1 mmol/L MgSO4, 3.7% formaldehyde, pH 7.4) for 1–2 h at room temperature and completely dehydrated using different grades of absolute ethanol. WISH was performed according to a previously described procedure [27 (link)]. Alkaline phosphatase (AP)-coupled anti-DIG antibody was used to recognize the DIG-labeled probe. Staining was conducted in BM Purple (Roche) at 37 °C. The embryos were observed under a stereomicroscope (SteREO Discovery. V8, Carl Zeiss, Jena, Germany), and the images were taken using a digital camera (AxioCam MRc, Carl Zeiss, Jena, Germany).
Chen H., Zhong K., Zhang Y., Xie L, & Chen P. (2022). Bisphenol A Interferes with Redox Balance and the Nrf2 Signaling Pathway in Xenopus tropicalis during Embryonic Development. Animals : an Open Access Journal from MDPI, 12(7), 937.
+ Open protocol
+ Expand
3

Chikungunya Virus Reporter Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Capped RNAs were generated from the CHIKV-D-Luc-SGR for transfection using the mMACHINE SP6 transcription kit (ThermoFisher Scientific) and purified with PureLink RNA Mini Kit (Life Technologies). Routinely 0.5 μg CHIKV-D-Luc-SGR was transfected into 106 cells using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions. At 4, 12, 24 and 48 h post transfection (h.p.t.), cells were harvested and both Renilla and Firefly luciferase activity measured using the Dual-luciferase Assay System (Promega) according to the manufacturer’s instructions. Each sample had three repeats and the data shown in this study represent the mean of three experimental replicates (n = 3).
Gao Y., Goonawardane N., Ward J., Tuplin A, & Harris M. (2019). Multiple roles of the non-structural protein 3 (nsP3) alphavirus unique domain (AUD) during Chikungunya virus genome replication and transcription. PLoS Pathogens, 15(1), e1007239.
+ Open protocol
+ Expand
4

TULP3 Variant Overexpression in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols
Wild-type and K316Q/K389Q variant human TULP3 sequences were cloned and ligated into pCS2+ vectors. Following linearization with NotI (NEB), mRNA was transcribed using the mMachine SP6 Transcription Kit (Invitrogen) and purified using Amicon Ultra-0.5 Centrifugal Filter columns (Ultracel-50; Fisher/Millipore). Wild-type zebrafish embryos were injected with either 100 pg of wild-type TULP3 or the K316Q/K389Q mutant TULP3 mRNA at the one-cell stage. gfp mRNA was prepared as above and used as a negative control.
Kerek E.M., Yoon K.H., Luo S.Y., Chen J., Valencia R., Julien O., Waskiewicz A.J, & Hubbard B.P. (2020). A conserved acetylation switch enables pharmacological control of tubby-like protein stability. The Journal of Biological Chemistry, 296, 100073.
+ Open protocol
+ Expand
5

CRISPR-Cas13d Mediated Zebrafish Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols
Briefly, 3 guide RNAs (gRNAs) were designed to disrupt the kmt2d gene in zebrafish with the following sequences: gRNA1: CTCAGCAGAGCTTGGCTGGGAGG; gRNA2: CGGCCTATCAAAACTGAACCTGG; gRNA3: CTGCTAAGCTCCTCTTCGCTGGG.
A DNA template to generate gRNA mRNA was generated by fill-in PCR. For RNA synthesis, PCR amplicons were purified and used as templates using T7 RNA polymerase (MAXIscript T7 Kit, Invitrogen) according to the manufacturer’s instructions. Cas13d were PCR-amplified using primers (Cas13d-SP6-kozak-F: 5′- ATTTAGGTGACACTATAGAAGTGCCGCCACCATGAGCCCCAAGAAGAAG-3′ and Cas13d-WPRE-R: 5′-ATTGCTACTTGTGATTGCTCCATG-3′) and also using addgene plasmid # 109049 (a gift from Pr. Lisa Li) as the template. Then, the Cas13d mRNA was synthesized using the mMACHINE SP6 Transcription Kit (Invitrogen). To increase mRNA depletion, the 3 gRNAs targeting the kmt2d gene were co-injected. One nanoliter containing 200 ng of Cas13d mRNA and 100 ng of gRNA mRNA were co-injected into the 1-cell stage zebrafish embryos.
Shangguan H., Huang X., Lin J, & Chen R. (2024). Knockdown of Kmt2d leads to growth impairment by activating the Akt/β-catenin signaling pathway. G3: Genes|Genomes|Genetics, 14(3), jkad298.
+ Open protocol
+ Expand
6

Targeting tgs1 in Zebrafish Embryos

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Control (non-targeting) and tgs1 morpholino oligonucleotides (MOs) were purchased from (GeneTools, LLC) using the tgs1 XM_003197865.5 sequence as reference. MO sequences are reported in Supplementary Table S11. For TGS1 mRNA injection, human TGS1 cDNA (NM_001317902) was cloned into an N-terminal flag-pCS2 + mRNA expression vector. In vitro transcription of 5′-capped mRNAs was performed using the mMACHINE SP6 Transcription Kit (Ambion) following the manufacturer's protocol and as previously described in (33 (link),34 (link)). Embryos from TL/EK wild-type crossings were used to visualize the CaP-MN phenotype. Embryos were injected with the respective dose of MOs or mRNA in an aqueous solution containing 0.05% PhenolRed and 0.05% Rhodamine-Dextran (Sigma-Aldrich). At 6–7 h after injection, embryos were sorted according to homogeneity of the rhodamine fluorescence signal.
Chen L., Roake C.M., Maccallini P., Bavasso F., Dehghannasiri R., Santonicola P., Mendoza-Ferreira N., Scatolini L., Rizzuti L., Esposito A., Gallotta I., Francia S., Cacchione S., Galati A., Palumbo V., Kobin M.A., Tartaglia G.G., Colantoni A., Proietti G., Wu Y., Hammerschmidt M., De Pittà C., Sales G., Salzman J., Pellizzoni L., Wirth B., Di Schiavi E., Gatti M., Artandi S.E, & Raffa G.D. (2022). TGS1 impacts snRNA 3′-end processing, ameliorates survival motor neuron-dependent neurological phenotypes in vivo and prevents neurodegeneration. Nucleic Acids Research, 50(21), 12400-12424.
+ Open protocol
+ Expand
7

Visualizing CaP-MN Phenotype in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols
Control (non-targeting) and tgs1 MOs were purchased from (GeneTools, LLC) using the tgs1 XM_003197865.5 sequence as reference. MO sequences are reported in Table S11. For TGS1 mRNA injection, human TGS1 cDNA (NM_001317902) was cloned into an N-terminal flag-pCS2+ mRNA expression vector. In vitro transcription of 5' capped mRNAs was performed using the mMACHINE SP6 Transcription Kit (Ambion) following manufacturer's protocol and as previously described in (33, 34) . Embryos from TL/EK wild-type crossings were used to visualize the CaP-MN phenotype. Embryos were injected with the respective dose of MOs or mRNA in and aqueous solution containing 0.05% PhenolRed and 0.05% Rhodamine-Dextran (Sigma-Aldrich). 6-7hr after injection, embryos were sorted according to homogeneity of the rhodamine fluorescence signal.
Chen L., Roake C.M., Maccallini P., Bavasso F., Dehghannasiri R., Santonicola P., Mendoza-Ferreira N., Scatolini L., Rizzuti L., Esposito A., Gallotta I., Francia S., Cacchione S., Galati A., Palumbo V., Tartaglia G.G., Colantoni A., Proietti G., Wu Y., Hammerschmidt M., Pittà C.D., Sales G., Salzman J., Pellizzoni L., Wirth B., Schiavi E.D., Gatti M., Artandi S.E., & Raffa G.D. (2020). TGS1 controls snRNA 3’ end processing, prevents neurodegeneration and ameliorates SMN-dependent neurological phenotypes in vivo.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!