Syringe filter

Quantification of serotonin (5-HT) and 5-hydroxy indole acetic acid (5-HIAA) in the hippocampal tissue were performed using high performance liquid chromatography (HPLC) with electrochemical detector as suggested by Mohanakumar et al., [21 (link)] using N-methylserotonin as internal standard. Briefly, 100 mg of hippocampal tissue was deproteinated at 4°C with 0.1 M perchloric acid containing 0.05% EDTA (1:10 dilution) followed by sonication and centrifugation at 10, 000 × g for 10 min at 4°C. The supernatant was filtered through syringe filters (0.22 μm, Millipore) and filtrate (10 μl) was injected directly into an HPLC system (Waters Corporation, USA) with C₁₈ analytical column (4.6 cm × 25 cm) using auto-sampler. The mobile phase contained 8.65 mMol heptane sulphonic acid/lit, 0.27 mMol EDTA/lit, 13% (v/v) acetonitrile, 0.4–0.45% (v/v) triethylamine and 0.20–0.25% (v/v) phosphoric acid. The flow rate was maintained at 0.7 ml/min and the electro- detection was performed at 0.74 V. The data were collected and integrated in a Waters 745B data module. Quantification of serotonin and 5-HIAA in samples was carried out using standard plot of serotonin and 5-HIAA and the results were expressed in ng/mg of wet tissue samples.

The cell-free supernatants (CFSs) of isolated LAB were prepared by modifying the method described by Lin et al. [2 (link)]. The isolated LAB strains were inoculated at an inoculum size of 2% (v/v) in MRS broth and cultured at 37 °C for 18 h. After 18 h of incubation, the bacterial suspension was centrifuged at 4000× g for 10 min at 4 °C and filtrated using 0.22 μm syringe filters (Millipore Co., Bedford, MA, USA).

Primers for CDC50A transcriptional variant 1 (GENE ID: 55754, HUGO Gene Nomenclature Committee) were designed and synthetised (Qiagen, up 5′ -GCGGAATTCGCCACCATGGCGATGAACTATAAC – 3′; down 5′ -GCCGCGGCCGCTTACTTATCGTCGTCATCCTTGTAATCTCCTCCTCCAATGGTAATGTCAGCTG - 3′, 1086 bp). CDC50A gene was amplified (35 cycles, 25 μl reactions with 10 pmol primers) and verified by sequencing. To generate cells stably up-regulated expressing CDC50A, the PCR amplified product was cloned into the pLVX-IRES-GFP virus vector, which was then cotransfected with the packaging plasmids pCMV-dR8.91 and pCMV-VSV-G into HEK-293 T cells. Viruses were harvested 48 hours post transfection and filtered with 0.45 μm syringe filters (Millipore, Milford, MA, USA).

The extracts UV spectrum had a single maximum of absorption at 280 nm and this aspect allowed us to treat the extracts as a single component. The EE was calculated using the following formula (Shi et al., 2014 (link)):
$EE\%=\frac{totalamountofdrug-freedrug}{totalamountofdrug}\times 100$
Where drug means the phenolic compounds under study (EF1, EF2 and Ole). Each preparation was filtered using the syringe filters with a porosity equal to 0.2 μm (Millipore, Italy). 100 μL of filtrate are taken and brought to a final volume of 5 mL with distilled water. The amount of free and total drug was calculated by using the V-530 spectrophotometer (JASCO) at 280 nm (Mazzotta et al., 2020 (link)).