Superscript 3 one step rt pcr system with platinum taq polymerase

Bacterial cultures were grown for four days in V. vinifera xylem sap to approximately 10⁷ cell mL^-1 (OD₆₀₀≈1.0) and then harvested by centrifugation at 16,000g at 4°C for 5 minutes. The cells were suspended in RNeasy lysis buffer (Qiagen, Valencia, CA), and then lysed by Trizol reagent (Invitrogen, Carlsbad, CA). RNA was purified using RNeasy columns (Qiagen) and treated with DNase I (Invitrogen). RNA was quantified using a Nanodrop 1000 spectrophotometer (NanoDrop, Wilmington, DE) and qualitatively analyzed on agarose gels, then 5 μg of total RNA was used for cDNA synthesis using the first-strand cDNA using SuperScript III One-Step RT-PCR System with Platinum Taq polymerase according to the manufacturer’s protocol (Invitrogen). The resulting cDNA was utilized for regular PCR with gene or domain-specific primers (Table 1). Aliquots of each amplicon were electrophoresed on a 1.2% agarose gel and visualized by ethidium bromide staining. Gels were photographed using the Kodak Image Station 440CF (Eastman Kodak Company, Rochester, NY) and images densitometrically quantified with the Image J software (National Institutes of Health, Bethesda, MD) according to the manufacturer’s instructions. The experiment was performed three to six independent times with three replicates each.

Primers were designed and optimised to target three novel exonised SVA transcripts identified in the UGGT2, MYO5A, and SLC25A12 genes identified in RNA sequencing data from the motor cortices of the individuals from the NIH NeuroBioBank cohort. Primers were also designed to evaluate the expression of CASP8 transcripts and the effects of the polymorphic SVA within its intron. Primers were located in the exons flanking the SVA and/or within the SVA itself (See Supplementary Materials Table S4 for details). The targets were amplified using SuperScript III One-Step Rt-PCR System with Platinum Taq Polymerase (Invitrogen, Waltham, MA, USA) under standard conditions and 20 ng of RNA from selected samples from the NIH NeuroBioBank cohort as input.

Equal concentrations of WT and mutant virus (1 RNA/cell) were mixed in DMEM or XXX cell culture medium and added to A549, A549 ZAP knockout, or AP-61 mosquito cells at 50% confluence. After 2 hours, the inoculum was replaced with culture medium. Ten μl of cell culture supernatant was passaged to fresh cells. After 2 passages, total RNA was isolated using TRIzol reagent according to the manufacturer’s protocol. RNA was reverse transcribed and part of the mutated region within the ZIKV genome was PCR amplified using SuperScript III One-Step RT-PCR System with Platinum Taq Polymerase (Invitrogen) together with either the 5′-aagtggagaaaaagatggg-3′ (WT and SCR) or 5′-gaggaaaaagagtggaagac-3′ (WT, CpG_1.0, CpG_max, and UpA_max) forward primers in combination with a 5′-gtgccctttctccatttggt-3′ reverse primer. Reverse transcription and PCR amplification were performed according to the manufacturer’s protocol with the reverse transcription at 50°C for 30 minutes and an annealing temperature during PCR amplification of 58°C in an Applied Biosystems 2720 thermocycler. The resulting DNA amplicons from the comparisons between WT and SRC were digested with BsaI-HFv2 (New England Biolabs), WT and CpG_1.0 or CpG_max with SalI-HF (New England Biolabs) and WT and UpA_max with HaeIII (Invitrogen) and ran on 2% agarose gels.

Viral RNA was extracted from the frozen mosquito bodies, legs, and CQPs using QIAamp Viral RNA Mini Kit (Qiagen, Germantown, MD, USA), following homogenization of samples with steel BBs in a TissueLyser II (Qiagen, Hilden, Germany) at 19.5 Hz for 3 min and centrifuged at 13,200 rpm for 5 min. Zika virus RNA was detected and quantified by quantitative CFX96 real-time PCR system (qRT-PCR) (BioRad Laboratories, Hercules, CA). The primer sequences used were F: 5′-CTTCTTATCCACAGCCGTCTC-3′ and R: 5′-CCAGGCTTCAACGTCGTTAT-3′, with probe sequence: 5′-/56 FAM/AGAAGGAGACGAGATGCGGTACAGG/3BHQ_1/-3′. Reactions were performed using SuperScript III One-Step RT-PCR System with Platinum Taq Polymerase (Invitrogen). The conditions of the qRT-PCR were 94 °C for 2 min, and 39 cycles of 94 °C for 15 s, 50 °C for 30 min, and 58 °C for 1 min. Titers of virus in mosquito tissues and saliva were quantified using a standard curve that compares cDNA synthesis to a range of ZIKV serial dilutions in parallel with plaque assays of the same dilutions of the virus, expressed as plaque forming unit equivalents (PFUe)/mL.