Genomic DNA is routinely extracted from mononuclear cell samples submitted to the Manchester Cancer Research Centre Haematological Tissue Biobank. Targeted sequencing for recurrent myeloid mutations, using either: (a) a 54 gene panel (TruSight™ Myeloid; Illumina), pooling 96 samples with 5% PhiX onto a single NextSeq high output, 2 × 151 bp sequencing run; VCF files were analyzed using Illumina’s Variant Studio software; (b) a 40 gene panel (Oncomine Myeloid Research Assay; ThermoFisher), processing eight samples per Ion 530 chip on the IonTorrent platform; data analysis performed using the Ion Reporter software; (c) a 27 gene custom panel (48 × 48 Access Array; Fluidigm) sequenced by Leeds HMDS on the MiSeq platform (300v2); or (d) MSK HemePACT33 targeting all coding regions of 585 genes known to be recurrently mutated in leukemias, lymphomas, and solid tumors. All panels provide sufficient coverage to detect minimum variant allele fraction 5% for all genes, except for the Access Array panel and SRSF2; all samples genotyped by this approach underwent manual Sanger sequencing of SRSF2 exon 1 using the following primers (tagged with Fluidigm Access Array sequencing adaptors CS1/CS2): Fwd: acactgacgacatggttctacacccgtttacctgcggctc, Rev: tacggtagcagagacttggtctccttcgttcgctttcacgacaa.
Oncomine myeloid research assay
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Oncomine Myeloid Research Assay is a targeted next-generation sequencing (NGS) panel that enables the evaluation of DNA and RNA biomarkers associated with myeloid malignancies. The assay is designed to detect mutations, fusions, and expression levels of genes commonly altered in myeloid disorders.
Automatically generated - may contain errors
Lab products found in correlation
Trusight myeloid, by Illumina (2 mentions)
Variant studio software, by Thermo Fisher Scientific (2 mentions)
Access array sequencing adaptors, by Standard BioTools (2 mentions)
Ion genestudio s5 system, by Thermo Fisher Scientific (1 mentions)
Ion ampliseq kit for chef dl8, by Thermo Fisher Scientific (1 mentions)
Ion ampliseq transcriptome human gene expression panel, by Thermo Fisher Scientific (1 mentions)
Transcriptome analysis console 4, by Thermo Fisher Scientific (1 mentions)
Ion ampliseq comprehensive cancer panel, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Massarray system, by Agena (1 mentions)
Maxwell rsc blood dna kit, by Promega (1 mentions)
Fetal bovine serum (fbs), by Merck Group (1 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (1 mentions)
Automacs pro separator, by Miltenyi Biotec (1 mentions)
7 protocols using oncomine myeloid research assay
1
Targeted Sequencing for Myeloid Mutations
2
Targeted Sequencing for Myeloid Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA is routinely extracted from mononuclear cell samples submitted to the Manchester Cancer Research Centre Haematological Tissue Biobank. Targeted sequencing for recurrent myeloid mutations, using either: (a) a 54 gene panel (TruSight™ Myeloid; Illumina), pooling 96 samples with 5% PhiX onto a single NextSeq high output, 2 × 151 bp sequencing run; VCF files were analyzed using Illumina’s Variant Studio software; (b) a 40 gene panel (Oncomine Myeloid Research Assay; ThermoFisher), processing eight samples per Ion 530 chip on the IonTorrent platform; data analysis performed using the Ion Reporter software; (c) a 27 gene custom panel (48 × 48 Access Array; Fluidigm) sequenced by Leeds HMDS on the MiSeq platform (300v2); or (d) MSK HemePACT33 targeting all coding regions of 585 genes known to be recurrently mutated in leukemias, lymphomas, and solid tumors. All panels provide sufficient coverage to detect minimum variant allele fraction 5% for all genes, except for the Access Array panel and SRSF2; all samples genotyped by this approach underwent manual Sanger sequencing of SRSF2 exon 1 using the following primers (tagged with Fluidigm Access Array sequencing adaptors CS1/CS2): Fwd: acactgacgacatggttctacacccgtttacctgcggctc, Rev: tacggtagcagagacttggtctccttcgttcgctttcacgacaa.
3
Comprehensive Cancer Gene Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Target sequencing for major tumor-related genes was conducted using the Ion AmpliSeq™ Comprehensive Cancer Panel (Thermo Fisher Scientific, 4477685), which covers all exons of 409 genes. The HBB gene was analyzed using a custom panel that included 5 amplicons designed by the AmpliSeq Designer. Gene expressions were examined using the Oncomine™ Myeloid Research Assay (Thermo Fisher Scientific, A36941) and the Ion AmpliSeq™ Transcriptome Human Gene Expression Panel (Thermo Fisher Scientific, A31446). Sequence libraries and templates were prepared using the Ion AmpliSeq Kit for Chef DL8 (Thermo Fisher Scientific, A29024), followed by the Ion 510™ & Ion 520™ & Ion 530™ Kit-Chef or Ion 540™ Kit-Chef (Thermo Fisher Scientific, A34461/A30011). Sequencing was performed on the Ion GeneStudio S5 System using the Ion 530 or 540 chip (Thermo Fisher Scientific, A27763/A27765). Reads were aligned to the hg19 reference or the hg19 AmpliSeq Transcriptome ERCC v1 reference. The sequence variants and fusion genes were analyzed using the Ion Reporter 5.20 (Thermo Fisher Scientific). The expression analysis was performed using the Transcriptome Analysis Console 4.0.2 (Thermo Fisher Scientific). Variant analysis of the sequence data was performed with the settings as shown in Table S1 .
4
JAK2 Mutation Detection Techniques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Between 2015 and 2017, JAK2 mutation testing was performed by quantitative polymerase chain reaction (qPCR) using the Roche 480 LightCycler (La Roche AG). Between 2018 and 2020, this testing was done by single nucleotide polymorphism (SNP) allelotyping using the Agena MassARRAY system (Agena Biosciences) or next-generation sequencing (NGS) using the Oncomine Myeloid Research Assay (ThermoFisher Scientific). Specifically, qPCR and SNP allelotyping assays detected the JAK2 V617F mutation; the NGS assay detected any JAK2 mutations, including V617F and mutations in exons 12–15.
5
Isolation and Characterization of AML and Healthy HSPCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The study was approved by the Institutional Ethical Review Board of Hospital Clinic of Barcelona (HCB/2018/0020). AML mononuclear cells were frozen in liquid nitrogen using fetal bovine serum (FBS) (Sigma) with 10% dimetylsulfoxide (DMSO) (Sigma). The mutational state of AML samples was analyzed on DNA extracted from total cells using Maxwell‐RSC Blood DNA Kit (Promega) and a next‐generation sequencing panel of mutations using the Oncomine Myeloid Research Assay (ThermoFisher).
Healthy HSPCs were obtained from Barcelona Blood and Tissue Bank upon Institutional Review Board approval (HCB/2018/0030). CD34+ cells were isolated using antihuman‐CD34 magnetic beads and the AutoMACS Pro‐Separator (Miltenyi Biotec) after Ficoll‐Hypaque gradient centrifugation (GE Healthcare).
Healthy HSPCs were obtained from Barcelona Blood and Tissue Bank upon Institutional Review Board approval (HCB/2018/0030). CD34+ cells were isolated using antihuman‐CD34 magnetic beads and the AutoMACS Pro‐Separator (Miltenyi Biotec) after Ficoll‐Hypaque gradient centrifugation (GE Healthcare).
6
Oncomine Myeloid NGS Assay Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All patients underwent molecular testing using the NGS-based Oncomine Myeloid Research Assay (ThermoFisher Scientific, Waltham, MA, USA), which was previously validated in our laboratory and implemented at our centre [20 (link),21 (link)]. This assay analyzes DNA for sequence variants in 40 key target genes (17 genes with full coverage and 23 genes with partial coverage, including clinically relevant “hotspot” regions) and RNA for 29 gene fusions, including 687 fusion partners associated with hematologic disorders. Variants are classified and interpreted by genome analysts, certified clinical molecular geneticists, and/or molecular pathologists following the AMP/ASCO/CAP joint guideline [22 (link)]. All variants identified as having a variant allele frequency (VAF) ≥ 5% were assessed and classified. Variants were classified into four tiers (Tier I to IV) based on their level of clinical significance in cancer diagnosis, prognosis, and/or therapeutics [22 (link)]. Variants classified as belonging to Tiers I and II were of strong clinical significance, Tier III variants had unknown clinical significance due to the lack of significant evidence, and Tier IV variants were benign or likely to be benign. Only Tier I and II variants at VAF ≥ 5% were reported and further analyzed in this study.
7
Oncomine Myeloid Research Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For patients whose diagnostic work-up did not include next-generation sequencing (NGS), molecular profiling was performed using the Oncomine Myeloid Research Assay (Thermo Fisher Scientific, Waltham, MA, USA) if DNA was available from the respective samples obtained at diagnosis, as described in the Supplementary Materials .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!