Simplechip plus kit

Immortalized white pre-adipocytes from WT and Mkk6^−/− mice were differentiated to adipocytes for 9 days and processed to extract chromatin according to SimpleChIP^® Plus Kit from Cell Signalling. Chromatin was immunoprecipitated with a THRα/THRβ antibody (C3) (ThermoScientific cat# MA1-215), and, after elution and purification, DNA analyzed by qRT-PCR using UCP1 enhancer primers (fw: TCTACAGCGTCACAGAGGGT, rv: TGATTTCTGCTCTTCTGGCA) and control primers against RPL30 intron 2 supplied by SimpleChIP^® Plus Kit. Results are expressed as % of input.

CD4 T cells were purified and nucleofected with the MPRA plasmid library, as described (n = 4). After 24 h, cells were harvested, resuspended in fresh media (10⁶ cells/ml) and cross‐linked (37% Formaldehyde to final concentration 1% for 10 min). This was then quenched with glycine (final concentration 0.125 M) for 5 min. After washing, cell pellets lysed for 10 min in lysis buffer with Complete Mini EDTA‐free Protease Inhibitor (Roche). Lysis buffer: 50 mM HEPES pH 7.9, 140 mM NaCl, 1 mM EDTA pH 8.0, 10% v/v Glycerol, 0.5% v/v IGEPAL CA‐630, 0.25% v/v Triton X‐100. Two cycles of sonication were performed (Bioruptor Pico, Diagenode) to remove contaminants without chromatin shearing. Triton X‐100 and NaCl were added to final concentrations of 1% and 100 mM, respectively. 10 μg of sheared chromatin were cleared by centrifugation (21,000 g, 10 min, 4°C), and immunoprecipitation was performed overnight at 4°C using an anti‐NFkBp65 antibody (1:100, clone D14E12; Cell Signaling) or an isotype control (1:500, rabbit IgG, Abcam; ab172730) with the SimpleChIP Plus kit (Cell Signaling). Sequencing libraries were prepared as described earlier (26 PCR cycles).

A ChIP assay was performed using a SimpleChIP Plus Kit (Cell Signaling Technologies (CST), Beverly, MA, USA) according to the kit's instructions. In short, 2 × 10⁶ HEK-293T cells were cultured in 10 cm dishes. Cells were crosslinked using 1% methanol, and the reaction was terminated by glycine. The chromatin was detached in micrococcal nuclease. Anti-IgG (negative control (NC), mouse monoclonal IgG (CST) and anti-STAT3 (1 : 1,000, sc-8019, Santa Cruz Biotechnology) were reacted with the Protein G magnet beads to form protein-nucleic acid complexes (immunoprecipitates). The chromatin precipitates were eluted and purified, and the enrichment of STAT3 fragments was quantified using qPCR.