Total RNA was extracted from the HUVECs and retinas using TRIzol reagent (Invitrogen). The RNA purity was determined using absorbance at 260 and 280 nm (A260/280). cDNA synthesis was performed using a reverse transcriptase kit (PrimeScript™ RT Reagent kit-Perfect Real-Time; Takara Bio, Otsu, Japan), according to the manufacturer's instructions. The primer sequences used in the HUVECs and retinas are presented in Table I . Quantitative (real-time) PCR was performed using the SYBR-Green PCR Master Mix (Premix Ex Taq™-Perfect Real-Time; Takara Bio) in a total volume of 20 µl on a 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). All reactions involved an initial denaturation at 95°C for 30 sec followed by 50 cycles of 95°C for 5 sec and 60°C for 31 sec. GAPDH was used as the reference gene. The Ct value was defined as the number of PCR cycles in which the fluorescence signal exceeded the detection threshold value. First, the ΔCt value was calculated as follows: Ct gene - Ct GAPDH. Subsequently, the ΔΔCt value was calculated as follows: ΔCt treated - ΔCt control. Lastly, the 2−ΔΔCt value was calculated to represent the relative mRNA expression of target genes, as previously described (36 (link)).
Premix ex taq perfect real time
Manufactured by Takara Bio
Sourced in Japan
Premix Ex Taq (Perfect Real Time) is a pre-mixed reagent designed for real-time PCR applications. It contains all the necessary components, including the DNA polymerase, dNTPs, and buffer, to perform accurate and efficient real-time PCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Sequence detection software version 1, by Thermo Fisher Scientific (2 mentions)
Applied biosystems 7300 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Tissue dna extraction kit, by Tiangen Biotech (2 mentions)
7300 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit perfect real time, by Takara Bio (1 mentions)
Rneasy mini qiacube kit, by Qiagen (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Lightcycler 96 system, by Roche (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq 2 tli rnaseh plus, by Takara Bio (1 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Qiazol lysis reagent, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Rneasy microrna isolation kit, by Qiagen (1 mentions)
Reverse transcriptase, by Takara Bio (1 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (1 mentions)
Sybr premix ex taq perfect real time, by Takara Bio (1 mentions)
Sensiscript reverse transcriptase, by Qiagen (1 mentions)
Rneasy micro kit, by Qiagen (1 mentions)
10 protocols using premix ex taq perfect real time
1
Quantitative PCR Analysis of Gene Expression
2
Comprehensive RNA Quantification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was purified from animal tissues using the RNeasy Mini QIAcube Kit (Qiagen). cDNA was synthesized from total RNA with a PrimeScript RT Reagent Kit (Takara Bio). mRNA amounts were quantified with Premix Ex Taq (Perfect Real Time) (Takara Bio), and the Applied Biosystems 7300 Real-Time PCR system (Thermo Fisher). The thermal profile was 95°C for 30 s, followed by 45 cycles of 95°C for 5 s and 60°C for 31 s. Data analysis was performed with Sequence Detection Software version 1.4 (Thermo Fisher). Mouse IL-6, mouse IL-1β, mouse TNFα, mouse CCL-2, mouse ZFP36, mouse Calbindin, mouse GFAP, mouse Nestin, mouse Sox2, mouse Mcm2, mouse DCX, mouse Calretinin, mouse HuR, mouse Roquin, mouse KHSRP, mouse Regnase-1, mouse AUF1, human 18S and SARS-CoV-2 S1 were measured using the primers and probes described in the key resources table .
3
Real-Time PCR Analysis of Defoliation-Induced Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The result of RNA-seq without biological replication (conducted by Hokkaido System Science Co. Ltd.) is shown in Table S1 Table 1 https://primer3.ut.ee/ ). Selected reverse transcripts were amplified by PCR. Aliquots of the PCR products were subjected to electrophoresis to verify the specificity of the primers. The aliquots of the PCR products were subjected to a series of 10-fold dilutions with EASY Dilution (for real-time PCR) solution (TaKaRa) and used to produce the calibration curve. C. sativus clone CU36H1 actin was used as the internal standard. Two μL reverse transcript solution was mixed with 1 μL forward primer (10 μM), 1 μL reverse primer (10 μM), 12 μL Premix Ex Taq™ (Perfect Real Time; TaKaRa) and 4 μL sterilized water on a PCR plate. The PCR plate was set in a LightCycler® 96 System (Roche, Basel, Switzerland). The cycle condition was 40 cycles of 95°C 5 seconds and 60°C 30 seconds.
4
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantitate expression of each gene, total RNA was extracted from cell cultures by direct lysis of cells on dishes using the QIAzol Lysis Reagent (Qiagen, Hilden, Germany), followed by RNA purification using RNeasy Mini Kits (Qiagen, Hilden, Germany). cDNAs were synthesized using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies, Danvers, MA, USA). Quantitative PCR analysis was performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems), using SYBR Premix Ex Taq II (Tli RNase H Plus) and Premix Ex Taq™ (Perfect Real Time) (Takara Bio, Shiga, Japan) for the SYBR Green method and TaqMan assays, respectively. Detailed sequences of the primer sets and the Assay IDs of the TaqMan assays used in this study are provided in the S7 and S8 Tables.
5
Quantifying Eye and Retinal Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To confirm the observed developmental changes, we evaluated the expression of several eye- and retina-specific marker genes (Supplemental Fig. S1 b). Retinal and anterior neural fold homeobox (RAX) are expressed early in the eye primordia and are essential for retinal development16 (link). PAX6 is essential for eye development and a candidate gene for congenital aniridia17 (link). POU4F2/BRN3B is expressed in RGCs18 (link) and suppresses the differentiation of other types of retinal cells. Total RNA was isolated from three to six EBs on days 3, 10, 17, 25, and 35 using an RNeasy microRNA isolation kit (QIAGEN, Japan). Isolated RNAs were treated with reverse transcriptase (TaKaRa, Ohtsu, Japan) to generate cDNA. The expression of marker genes of eyes and retinal development (RAX, PAX6, and POU4F2) was assessed using real-time qPCR with the following primers:S1 b).
RAX forwards: CCCTAAGCGTGCTTTCAGGA
RAX reverse: TTTGCTCAGGACCGACAGAC
PAX6 forwards: TGGCTCACCAAGGCGAAATA
PAX6 reverse: CCGAGCAGTTGAGTCATTCAG
POU4F2 forwards: GAACGAGCGAACAACTGAGC
POU4F2 reverse: CTCTGAAGAAGCCGAGGTGG
SCS (18S) forwards: TGTGTGAAAGATTAAGCATGCA
SCS (18S) reverse: GCGACCAAAGGAACCATAACTG
6
Quantitative Real-Time PCR for WSSV Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR was performed to measure the WSSV copies in shrimp. The viral DNA was extracted from shrimp gills using a tissue DNA extraction kit (Tiangen, China), and the WSSV copies were detected by real-time PCR with WSSV-specific primers (5’-TTGGTTTCAGCCCGAGATT-3’ and 5’-CCTT GGTCAGCCCCTTGA-3’) and a WSSV-specific TaqMan probe (5’-FAM-TGCTGCCGTCTCCAA-Eclipse-3’) [27 (link)]. A linearized plasmid containing a 1400 bp DNA fragment from the WSSV genome was quantified and serially diluted 10-fold as an internal standard for real-time PCR. The 10 μl PCR solution contained 5 μl of Premix Ex Taq (Perfect Real Time) (TaKaRa, Japan), 0.2 μl of 10 μM forward primer, 0.2 μl of 10 μM reverse primer, 0.15 μl of 10 μM TaqMan fluorogenic probe, 200 ng of DNA template, and distilled water up to 10 μl. The real-time PCR conditions were 95°C for 1 min followed by 45 cycles of 30 s at 95°C, 30 s at 52°C, and 30 s at 72°C.
7
Laser Capture Microdissection of Osteoarthritic Cartilage
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For LCM, cartilage tissues were obtained from 16 OA knees and 9 control knees, at 3–5 sites per knee. OA cartilage samples were harvested from both the macroscopically intact areas (preserved areas) and the areas showing various degrees of cartilage degeneration (degenerated areas). At each site, approximately 20 mm × 5 mm of cartilage was obtained in full thickness above the tide mark. The separation of cartilage zones by LCM was performed following a previously described method [5 (link), 24 (link)]. In brief, cryosections were prepared from the cartilage tissues in a plane vertical to the joint surface, which were separated into three cartilage zones using an LCM device (PixCell IIe; Arcturus, Mountain View, CA, USA) based on the histological features.
Immediately after LCM, RNA was extracted from the respective cartilage zones using an RNeasy Micro kit (Qiagen GmbH, Hiden, Germany) with routine use of DNase I (Qiagen). cDNA was synthesized using Sensiscript reverse transcriptase (Qiagen). The gene expression was evaluated quantitatively by real-time PCR on a LightCycler (Roche Diagnostics, Basel, Switzerland), using gene-specific primers and probes (Additional file1 : Table S1). SYBR® Premix Ex Taq® Perfect Real Time (Takara Bio, Shiga, Japan) or Premix Ex Taq® Perfect Real Time (Takara Bio) was used for PCR. The cDNA levels were normalized by the expression of GAPDH.
Immediately after LCM, RNA was extracted from the respective cartilage zones using an RNeasy Micro kit (Qiagen GmbH, Hiden, Germany) with routine use of DNase I (Qiagen). cDNA was synthesized using Sensiscript reverse transcriptase (Qiagen). The gene expression was evaluated quantitatively by real-time PCR on a LightCycler (Roche Diagnostics, Basel, Switzerland), using gene-specific primers and probes (Additional file
8
Quantitative WSSV Detection in Shrimp
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The WSSV copies of shrimp were determined by quantitative real-time PCR (qPCR). DNA extracted from shrimp hemocytes using a tissue DNA extraction kit (Tiangen) was subjected to qPCR with WSSV-specific primers (5′-TTGGTTTCAG CCCGAGATT-3′ and 5′-CCTTGGTCAGCCCCTTGA-3′) and probe (5′-FAM-TGC TGCCGTCTCCAA-Eclipse-3′). A linearized plasmid containing a 1400-bp DNA fragment from the WSSV genome was quantified and serially diluted as an internal standard. The 10 μl PCR solution contained 5 μl of Premix Ex Taq (Perfect Real Time) (TaKaRa), 0.2 μl of 10 μM forward and reverse primer respectively, 0.15 μl of 10 μM probe, 200 ng of DNA template, and distilled water up to 10 μl. The PCR program was 95°C for 1 min, followed by 45 cycles of 30 s at 95°C, 30 s at 52°C, and 30 s at 72°C.
9
Quantification of Salivary HHV-6 DNA via Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Salivary HHV-6 DNA was measured according to our previously published procedure.70 (link) Briefly, purified samples obtained from saliva were quantified by real-time PCR with an Applied Biosystems 7300 real-time PCR System (Thermo Fisher Scientific Inc.). The amplifications were performed in duplicate in a total volume of 50 μL containing 25 μL of Premix Ex Taq (Perfect Real Time) (Takara Bio Inc.), 0.45 μL of 100 μM PCR forward primer, 0.45 μL of 100 μM PCR reverse primer, 1.25 μL of 10 μM TaqMan probe, 1 μL of Rox reference dye, 5 μL of the extracted viral DNA solution, and 16.85 μL of PCR-grade water. The primers used for real-time PCR were as follows: HHV-6 forward primer, 5′-GACAATCACATGCCTGGATAATG-3′; HHV-6 reverse primer, 5′-TGTAAGCGTGTGGTAATGGACTAA-3′; HHV-6 probe, 5′-FAM-AGCAGCTGGCGAAAAGTGCTGTGC-TAMRA-3′. The thermal profile was 95°C for 30 s, followed by 50 cycles of 95°C for 5 s and 60°C for 31 s. Data analysis was performed using Sequence Detection Software version 1.4 (Thermo Fisher Scientific Inc.).
10
Quantifying SCRV N Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three largemouth Basses from each group were sampled from the rst day to the fourteenth day, then on the twenty-rst and twenty-eighth days. The different tissues were collected and were stored at -80°C until use.
The viral RNA copy numbers were detected by quantitative real-time RT-PCR (qRT-PCR).First, RNA was extracted using TRIzol reagent (Invitrogen, NY, USA) according to the manufacturer's protocol. Then, the isolated RNA was reverse transcribed using the First Strand cDNA Synthesis Kit (Takara, Japan). The cDNA was used as a template for qRT-PCR, which was performed using PremixExTaq™ (PerfectRealTime) (Takara, Japan) to assay samples with the following SCRV N gene-speci c primers: F, 5'-GACATGTTCTTCTACAGATTCAAC-3' and R, 5'-CAATCCAGCACTCCACTG-3'. The probe was 5'-AGGTTCAAAGACTGTGCAGCTCTGT-3', which was labeled on its 5'endwithFAMandonits3'endwithEclipse. To estimate virus replication, virus-speci c mRNA expression was measured using qRT-PCR and was expressed as the number of RNA copies per mg of tissue. The results were analyzed using Applied Biosystems 7500software.
The viral RNA copy numbers were detected by quantitative real-time RT-PCR (qRT-PCR).First, RNA was extracted using TRIzol reagent (Invitrogen, NY, USA) according to the manufacturer's protocol. Then, the isolated RNA was reverse transcribed using the First Strand cDNA Synthesis Kit (Takara, Japan). The cDNA was used as a template for qRT-PCR, which was performed using PremixExTaq™ (PerfectRealTime) (Takara, Japan) to assay samples with the following SCRV N gene-speci c primers: F, 5'-GACATGTTCTTCTACAGATTCAAC-3' and R, 5'-CAATCCAGCACTCCACTG-3'. The probe was 5'-AGGTTCAAAGACTGTGCAGCTCTGT-3', which was labeled on its 5'endwithFAMandonits3'endwithEclipse. To estimate virus replication, virus-speci c mRNA expression was measured using qRT-PCR and was expressed as the number of RNA copies per mg of tissue. The results were analyzed using Applied Biosystems 7500software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!