Hydrogen tetrachloroaurate(III) trihydrate (HAuCl4•3H20, 99.9%), silver nitrate (AgNO3, 99%), L-ascorbic acid (AA; C6H8O6, ≥98%), sodium borohydrate (NaBH4, 98%) and sodium deoxycholate (C24H39NaO4, ≥97%) were used as purchased from Sigma-Aldrich (St. Louis, USA). Carboxy-PEG-thiol (MW. 5K) was purchased from Laysan Bio (Arab, Al, USA). 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), N-Hydroxysuccinimide (NHS) were purchased from Pierce (Thermo Scientific Inc., Rockford, IL, USA). c(RGDfE) (cyclo(Arg-Gly-Asp-D-Phe-Glu)) peptide was purchased from Peptides International Inc. (Louisville, KY,USA). Cyto780 near infrared fluorescent dye was purchased from Cytodiagnostics (Ontario, Canada). For MTT assay, 3-[4 (link),5 (link)–dimethylthiazol-2-yl]-3,5-diphenyltetrazolium bromide salt and dimethylsulfoxide (DMSO) were purchased from Sigma Chemicals Co. (St. Louis, USA). All chemicals were used without further purification. Milli-Q water (Millipore Corp. Billerica, MA, USA) was used throughout the experiments.
Hydrogen tetrachloroaurate 3 trihydrate
Manufactured by Merck Group
Sourced in United States, Germany
Hydrogen tetrachloroaurate (III) trihydrate is a chemical compound with the formula HAuCl4·3H2O. It is a yellow crystalline solid used as a precursor in the synthesis of various gold compounds and nanoparticles.
Automatically generated - may contain errors
Lab products found in correlation
Sodium borohydride, by Merck Group (8 mentions)
Sodium hydroxide (naoh), by Merck Group (8 mentions)
Trisodium citrate dihydrate, by Merck Group (4 mentions)
Trisodium citrate, by Merck Group (4 mentions)
Silver nitrate, by Merck Group (4 mentions)
Hydrochloric acid (hcl), by Merck Group (3 mentions)
Tetraethyl orthosilicate, by Merck Group (3 mentions)
Ethanol, by Merck Group (3 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (3 mentions)
L ascorbic acid, by Merck Group (3 mentions)
Ascorbic acid, by Merck Group (3 mentions)
Bovine serum albumin (bsa), by Merck Group (3 mentions)
Milli q water, by Merck Group (2 mentions)
Cetyltrimethylammonium bromide, by Merck Group (2 mentions)
4 2 hydroxyethyl 1 piperazineethanesulfonic acid, by Merck Group (2 mentions)
Oleic acid, by Merck Group (2 mentions)
Oleylamine, by Merck Group (2 mentions)
Acetic acid, by Merck Group (2 mentions)
Adenine, by Merck Group (2 mentions)
Glutathione (gsh), by Merck Group (2 mentions)
47 protocols using hydrogen tetrachloroaurate 3 trihydrate
1
Synthesis and Functionalization of Gold Nanoparticles
2
Pluronic Micelles for Antioxidant Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pluronic F127 ((PEO)200(PPO)65(PEO)200, Mw 12600), Pluronic P104 ((PEO)54(PPO)63(PEO)54, Mw 5900), Pluronic P85 ((PEO)52(PPO)40(PEO)52, Mw 4600) and Pluronic F88 ((PEO)208(PPO)39(PEO)208, Mw 11400), were supplied by BASF corporation. Hydrogen tetrachloroaurate (III) trihydrate (HAuCl4·3H2O), PEO (Mw 8000), sodium chloride (NaCl), hydrochloric acid (HCl), sodium hydroxide (NaOH), 4-acetamidophenol (AAP), horseradish peroxidase (HRP), and diethylenetriaminepentaacetic acid (DTPA) were purchased from Sigma-Aldrich, St. Louis, MO. 1-Hydroxy-3-methoxycarbonyl-2,2,5,5-tetramethylpyrrolidine (CMH), EPR buffer, diethyldithiocarbamic acid sodium salt (DETC), and deferoxamine (DF) were purchased from Noxygen Science Transfer and Diagnostics, Elzach, Germany All reagents were used as received without farther purification. All aqueous solutions were prepared using bi-distilled water (Millipore, Billerica, MA, USA).
3
Synthesis of Gold Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hydrogen tetrachloroaurate-(III) trihydrate (HAuCl4 ∙ 3H2O, 99.99%), sodium borohydride (NaBH4), Hexadecyltrimethylammonium bromide (CTAB, 96%), Cetyltrimethylammonium chloride solution (CTAC), ascorbic acid (AA) and Whatman® qualitative filter paper, Grade 1 (Whatman no. 1) were purchased from Sigma-Aldrich (St. Louis, MO, USA). The synthetic RRWHRWWRR-NH2 polypeptide (further noted as P2) was synthetized by Pierce Protein Biology, Thermo Fisher Scientific (Mt Prospect, IL, USA). All chemicals were of analytical grade, and all aqueous solutions were prepared using ultrapure water (resistivity~18 MΩ).
4
Synthesis of Gold Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All chemicals were obtained from commercial suppliers and used without further purification. Cetyltrimethylammonium bromide (CTAB>98.0%), hydrogen tetrachloroaurate (III) trihydrate (HAuCl4•3H2O), sodium borohydride (NaBH4, 99%), silver nitrate (AgNO3, >99%), L-ascorbic Acid (BioUltra, ≥99.5%) and hydrochloric acid (HCl, 37 wt.% in water) were purchased from Sigma-Aldrich. Sodium oleate (NaOL, >97.0%) was purchased from TCI America. SH-PEG-CH3 (methoxy PEG Thiol, MW5000) was purchased from JenKem Technology Co., Ltd. Deionized (DI) water was used in all experiments.
5
Synthesis of GFP-labeled Protein Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hydrogen tetrachloroaurate (III) trihydrate (HAuCl4·3H2O, 99.9%), hexylsilane, bovine serum albumin (BSA), polyethylene glycol thiol (PEG, Mw = 20,000), and phosphate-buffered saline (PBS) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Dopamine (99%) and tris(hydroxymethyl)methyl aminomethane (Tris, 99.9%) were purchased from Aladdin Technology Co, Ltd. (Hong Kong, China). Anti-adenovirus hexon protein antibody (ab252760) was purchased from Abcam (Cambridge, UK). Factor X protein (11,076-H08B) was purchased from Sino Biological Inc. (Beijing, China). GFP-specific primers were synthesized by Tsingke Biotechnology Co, Ltd. (Beijing, China) (forward, 5′–TATATCATGGCCGACAAGCAGAAG–3′ and reverse, 5′–CTGGGTGCTCAGGTAGTGGTTGT–3′). All chemicals were used without further purification.
6
Synthesis of Metal Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hydrogen tetrachloroaurate(III) trihydrate (HAuCl4·3H2O), L-glutathione reduced form (GSH), and sodium borohydride (NaBH4) from Sigma Aldrich; hydrochloric acid (HCl) from J. T. Baker; zinc chloride (ZnCl2), silver nitrate (AgNO3) and sodium hydroxide (NaOH) from Merck; and cadmium chloride (CdCl2) from Strem were used as received without further purification. Ultrapure Milipore water (18.2 MΩ) was used in the preparation of all aqueous solutions. All glassware was washed with aqua regia and rinsed with ethanol and ultrapure water before use.
7
Synthesis and Characterization of Gold Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following chemicals were purchased from Sigma-Aldrich Chemie GmbH and were used as received: hydrogen tetrachloroaurate(iii ) trihydrate (HAuCl4·3H2O), trisodium citrate dihydrate (C6H5Na3O7·2H2O), MOA, 4-(2-hydroxyethyl)-1-piperazine-ethanesulfonic acid (HEPES), tris(hydroxymethyl)aminomethane (TRIS), and 3-triethoxysilylpropylamine (APTES). Glass beads were purchased from Carl Roth GmbH + Co. KG. AOT was purchased from Dojindo Molecular Technologies, Inc. All glassware was cleaned with aqua regia and rinsed with copious amount of water prior to use. Ultrapure water with a conductivity <55 nS cm−1 was used for all procedures.
8
Synthesis of Multifunctional Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Iron (II) chloride tetrahydrate (FeCl2.4H2O) (>99 %), platinum (II) acetylacetonate, (Pt(acac)2) (>99.9 %), oleylamine (cis-1-amino-9-octadecene (≥98 %), oleic acid (cis-9-octadecenoic acid (>99 %), benzyl ether, cyclohexane (99.5 %)), IGEPAL® CA-520 (octylphenoxy poly(ethyleneoxy) ethanol, branched), tetraethyl orthosilicate (TEOS) (99.99 %), ammonia (≥99 %), N-[3-(trimethoxysilyl) propyl] ethylenediamine (energy-dispersive X-ray spectroscopy (EDS)) (97 %), acetic acid (CH3COOH, ≥99 %), trisodium citrate dihydrate (Na3C6H5O7 · 2H2O, ≥99.5 %), hydrogen tetrachloroaurate (III) trihydrate (HAuCl4 · 3H2O, 99 %), and adenine (C5H5N5, ≥99 %) were purchased from Sigma Aldrich, St. Louis, MO, USA. Ethyl alcohol (ethanol, analytical standard) was purchased from Fluka Analytical, USA. Agar Bacteriological was purchased from Oxoid. Luria-Bertani (LB Broth) was purchased from DifcoTM. High-purity water purified by a Milli Q Plus water purifier system (Milipore, USA), with a resistivity of 18.3 M Ω cm, was used in all experiments. All the chemicals were used without further purification.
9
Sensitive Detection of E. coli O157:H7
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rabbit polyclonal anti-E. coli O157:H7 antibody and mouse monoclonal anti-O157:H7 antibody were prepared and purified in our laboratory. Single-stranded DNA 5′(biotin)-GCTAGTGAACACAGTT-GTGTAAAAAAAAAA (SH)-3′ was synthesized by Sangon Biotech Co., Ltd. (China). Streptavidin-horseradish peroxidase (Strep-HRP) and peroxidase-conjugated affinipure goat anti-rabbit IgG (IgG-HRP) were purchased from Beijing Biosynthesis Biological Technology Co., Ltd. (China). Bovine serum albumin (BSA), 3,3′,5,5′- tetramethylbenzidine (TMB-H2O2), and hydrogen tetrachloroaurate (III) trihydrate (HAuCl4 · 3H2O, 99.9%) were purchased from Sigma-Aldrich (USA). Dextran with a molecular weight of 40,000 (T-40) was obtained from Pharmacia (GE Healthcare, USA). Sorbitol-MacConkey agar (SMAC) and xylose-lysine-tergitol 4 (XLT4) agar were purchased from Difco (Becton Dickinson, USA). Ferric chloride hexahydrate (FeCl3 · 6H2O), ferrous chloride tetrahydrate (FeCl2 · 4H2O), and other chemicals were of analytically pure grade or better quality. The buffer solutions were prepared in our laboratory. All aqueous solutions were prepared using ultrapure water (18.0 MΩ/cm) as required.
10
Synthesis and Characterization of Graphene Oxide
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The materials used in this study were as follows: graphite powder, <20 μm, synthetic, Aldrich; sulfuric acid, H2SO4, 96.5 %, Baker; fuming nitric acid, HNO3, ≧99.5 %, Sigma-Aldrich; potassium permanganate, KMnO4, Baker; PDDA, 35 % (average Mw < 100,000), Aldrich; hydrogen peroxide, H2O2(aq), 35 %, Acros; hydrochloric acid, HCl(aq), 37 %, Scharlau; sodium citrate dehydrate, Na3Ct·2H2O, ≧99.5, Sigma-Aldrich; hydrogen tetrachloroaurate(III) trihydrate, HAuCl4·3H2O, 99 %, Sigma-Aldrich; nitric acid, HNO3(aq), 69 %, Panreac; silicon Oil, Choneye Pure Chemical; Luria-Bertani (LB broth), Difco™ (Agar Bacteriological), Oxoid; and adenine, C5H5N5, ≧99 %, Sigma.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!