Fastgene scriptase 2 cdna kit

Total RNA was extracted from cells using RNAiso plus (Takara Bio Inc., Shiga, Japan) and quantified with a BioSpec-nano spectrophotometer (Shimadzu Inc., Kyoto, Japan). Subsequently, 1 μg RNA was converted to cDNA using the FastGene Scriptase II cDNA Kit (NIPPON Genetics, Düren, Germany). To carry out Quantitative Real-Time PCR analyses, the 5x HOT FIREPol^® EvaGreen^® qPCR Supermix (Solis BioDyne, Tartu, Estonia) and PikoReal^TM Real-Time PCR System (Thermo Fisher Scientific Inc., Waltham, MA, USA) were used. Specific primers for the human genes studied were as described before [42 (link)]. The HMBS gene was used as a normalizer.

Total RNA was isolated from lymphoblastoid cell lines (LCLs) using TRIzol (Thermo Fisher Scientific) and treated with DNase I (Takara Bio, Shiga, Japan). Complementary DNA (cDNA) was synthesized from 1 μg of RNA using the FastGene Scriptase II cDNA kit (NIPPON Genetics Co., Tokyo, Japan). RT‐PCR was performed using two different sets of primers flanking exon 7 of GSDMD in which c.823G > C is located. RT‐PCR products were separated by agarose gel electrophoresis and subjected to Sanger sequencing using the BigDye Terminator 3.1 Cycle Sequencing Kit (Applied Biosystems, Carlsbad, CA, USA) and 3730xl DNA Analyzer (Applied Biosystems). qRT‐PCR was performed using the KAPA SYBR FAST qPCR Master Mix (KAPA Biosystems, Wilmington, MA, USA) on a 7500 Real‐time PCR System (Applied Biosystems). Primer sequences used in RT‐PCR and qRT‐PCR are available upon request. The RT‐PCR analysis for mouse Gsdmd and Gsdme was performed as described (Supplemental Fig. S3).

The cDNA of the isolated total RNA was synthesised using the FastGene Scriptase II cDNA Kit (Nippon Genetics, Dueren, Germany) and an oligo (dT) primer. Then, the cDNA of the target gene was amplified applying the Phusion High Fidelity Polymerase (Thermo Fisher Scientific, St. Leon-Roth, Germany) with the two specific primers ScoFAD-For (5’- TCGAATATGCCTGGCACTTGG -3’) and ScoFAD-Rev (5’- TCCATCACATCTCTACAGGGTAGG -3’) derived from a genomic sequence (XM_003032814.1) published by Ohm et al. [14 (link)]. The product was blunt-end ligated to pUC57 linearised with Eco321. The consensus sequence was obtained from five independent positive clones.

VDR, CYP24A1, CYP27B1, TRPV6, CAT, SLC37A2 and IGFBP3 expression in the different cell lines were determined by qRT-PCR. Total RNA was isolated from cells using the InnuPrep RNA mini kit (Analytikjena) according to the manufacturer’s instructions. Reverse transcription was performed using the SuperScript™ II Reverse Transcriptase (FastGene Scriptase II cDNA kit, Nippon Genetics) from 500 ng RNA and diluted 1/10 before analysis. qPCR reactions were performed with the SYBR Green Mastermix (Life Technologies) or TaqMan Fast Universal PCR master mix (Applied Biosystems, Foster City, CA, USA) in a 7500 Fast sequence detector system (Applied Biosystems). Relative gene expression was calculated with the 2^-ΔΔCt method. Gene expression levels were normalized to the expression of GAPDH. All qRT-PCR reactions were performed in triplicate. Sequences of primers and probes are summarized in Table 1.

For qRT-PCR analysis of gene expression, A. thaliana plants untreated or treated with 10 µM or 100 µM CA, were subjected to harvesting of leaves 6 or 24 h after toxin administration. Total RNA was extracted from 100 mg of homogenized leaves using RiboZOL (vWR, Radnor, PA, USA). For cDNA synthesis, 20 μg of total RNA was retro-transcribed by using the FastGene Scriptase II cDNA kit (Nippon Genetics Europe, Düren, Germany), according to the manufacturer’s instructions, and stored at −80 °C until use. qRT-PCR experiments were performed according to [47 (link)], using the LightCycler apparatus (Roche, Basel, Switzerland) and the SYBR GREEN dye (PCR Biosystems, London, UK). The 2^−ΔΔCt method was applied to evaluate the level of gene expression, using the actin-8 A. thaliana gene (ACT8) as housekeeping gene. Results represent mean values ± SD of independent experiments (n = 3). Samples were run in technical triplicates. Statistic significance was attributed by Student’s test (p < 0.05). The primers used for amplification are listed in Supplementary Table S1.

Total RNA was extracted from 100 mg of A. thaliana leaves using the RNeasy Plant Mini Kit RNA from Qiagen (Germantown, MD). Two micrograms of RNA were used for retro-transcription with FastGene Scriptase II cDNA-Kit (Nippon Genetics Europe, Düren, Germany). qPCR was performed in triplicates by using specific qPCR primers (Sigma-Aldrich Corporation, St. Louis, MO), the qPCRBIO SyGreen Mix (PCR Biosystem, London, UK) and the Real-Time PCR Light-Cycler II (Roche Diagnostics, Indianapolis, IN). mRNA levels were normalized to actin (ACT8), GAPDH and tubulin beta chain (TUB8) transcripts, and the relative mRNA levels were determined by using the 2-ΔΔCt method (Pfaffl, 2001 (link)). The primer sequences are listed in Supplemental Table S1.

For qRT-PCR analysis of gene expression, leaves from two-week-old tomato plants, untreated or treated with 20 µM or 200 µM DOR, were harvested 3 days after toxin administration. Total RNA was extracted from 100 mg of homogenized leaves using RiboZOL (vWR, Radnor, PA, USA). For cDNA synthesis, 20 μg of total RNA was retro-transcribed by using the FastGene Scriptase II cDNA kit (Nippon Genetics Europe, Düren, Germany), according to the manufacturer’s instructions, and stored at −80 °C until use. qRT-PCR experiments were performed, as previously described [35 (link)], using the LightCycler apparatus (Roche, Basel, Switzerland) and the SYBR GREEN dye (PCR Biosystems, London, UK). The 2^−ΔΔCt method was applied to evaluate the level of gene expression, using the ACT3 and UBI3 genes of S. lycopersicum as housekeeping genes. Results represent mean values ± SD of independent experiments (n = 3). Samples were run in technical triplicates. Statistical significance was attributed by Student’s test (p < 0.05). The primers used for amplification are listed in Supplementary Table S1.