Small RNAs were isolated from seedlings of 4-day-old plants using mirVana™miRNA Isolation Kit (Ambion, AM1561). Small RNA about three micrograms was fractionated on a 15% polyacrylamide gel containing 8M urea, and then transferred to a nylon transfer membrane (GE Healthcare). The antisense oligonucletides (S3 Table ) were synthesized and 3’end-labeled as probes with biotin. Hybridization was performed overnight at 42°C in hybridization buffer (Ambion, AM8663). A probe complementary to U6 (5’CATCCTTGCGCAGGGG CCA 3’) was used as a loading control.
Nylon transfer membrane
Manufactured by GE Healthcare
Sourced in United Kingdom
The Nylon transfer membrane is a laboratory equipment used for the transfer and immobilization of biomolecules, such as proteins and nucleic acids, from electrophoretic gels onto a solid support. It serves as a versatile substrate for various blotting techniques, enabling the efficient and reliable detection and analysis of the transferred analytes.
Automatically generated - may contain errors
Lab products found in correlation
Mirvana mirna isolation kit, by Thermo Fisher Scientific (3 mentions)
Hybridization buffer, by Thermo Fisher Scientific (3 mentions)
Las 1000 mini, by Fujifilm (1 mentions)
Chemiluminescent nucleic acid detection module kit, by Thermo Fisher Scientific (1 mentions)
Chemidoc mp imaging system, by Bio-Rad (1 mentions)
5 protocols using nylon transfer membrane
1
Small RNA Isolation and Analysis
2
Northern Blot Analysis of dsRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples of dsRNA (2-μg) were electrophoresed on 1% agarose–2.2 M formaldehyde gels and blotted onto Nylon Transfer Membrane (GE Healthcare). The hybridization probes used in this study were generated by PCR using the primers listed in Supplementary Table S3 . Probes were labeled with AlkPhos Direct (GE Healthcare) and visualized using an LAS-1000 mini (Fujifilm co.).
3
Isolation and Detection of Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small RNAs were isolated from seedlings of 22-day-old plants or inflorescences using mirVana™miRNA Isolation Kit (Ambion, AM1561). Three micrograms of small RNAs were separated on a 15% polyacrylamide gel with 8 M urea and transferred to a nylon transfer membrane (GE Healthcare). The antisense oligonucletides (S3 Table ) were synthesized and 3’end-labeled with biotin. Hybridization was performed overnight in hybridization buffer (Ambion, AM8663) at 42°C. A probe complementary to U6 (5’CATCCTTGCGCAGGGGCCA 3’) was used as a loading control.
4
Northern Blot RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One microgram of RNA extracted from NETN100 pellets or three micrograms of RNA extracted from NETN100 soluble fraction was respectively separated on 1% formaldehyde agarose gels and transferred into a nylon transfer membrane (GE Healthcare, UK) using 20× SSC (0.3 M sodium citrate; 3 M sodium chloride). After UV cross-linking, the membrane pre-hybridization was carried out at 42°C in a hybridization buffer (Invitrogen, Lithuania). The 5′-biotin labeled oligonucleotide probe was added after 3 h and incubated overnight at 42°C. The sequences of all the probes are as follows: U6 snRNA: ATATGGAACGCTTCACGAATT; ct-tRNALys: CGCCTGAACAGGGACTTGAACCCTGGACCC; 18S: ACGGCGACTACCATCGAAAG; 28S: AACGATCAGAGTAGTGGTATTTCACC; ITS1: CCTCGCCCTCCGGGCTCCGTTAATGATC; ITS2: GCGCGACGGCGGACGACACCGCGGCGTC. The signals were visualized with the Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Fisher, IL, USA) and imaged using ChemiDocTM MP Imaging System (Bio-Rad, CA, USA).
5
Plant Small RNA Gel Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small RNA gel blot was performed as previously described24 (link). Small RNAs were isolated from 4-day-old plant seedlings by using mirVana miRNA Isolation Kit (Ambion, AM1561). Small RNAs of about three micrograms were fractionated on a 15% polyacrylamide gel containing 8 M urea and then transferred to a nylon transfer membrane (GE Healthcare). Antisense oligonucleotides (Table S2 Supplemental information) were synthesized and biotin probes were labeled at 3′ end. Hybridization was carried out overnight in Ambion (AM8663) at 42 °C. A probe complementary to U6 (5′CATCCTTGCGCAGGGGCCA 3′) was used as a loading control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!