Total RNA was extracted from 80 mg rapeseed bee pollen using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Quantitative RT-PCR was performed using Taqman miRNA probes (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's instructions. To calculate the absolute expression levels of target miRNAs, a series of synthetic miRNA oligonucleotides at known concentrations were reverse transcribed and amplified. The absolute amount of each miRNA was then calculated with reference to the standard curve. Quantitative PCR was performed using an ABI-StepOnePlus machine (Applied Biosystems).
Abi steponeplus machine
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI StepOnePlus is a real-time PCR system designed for a variety of applications, including gene expression analysis, SNP genotyping, and pathogen detection. The system features a compact footprint and intuitive software interface, making it suitable for use in both research and clinical laboratory settings.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Trizol reagent, by Takara Bio (2 mentions)
Mirvana rna extraction kit, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Taqman fast advanced master mix, by Thermo Fisher Scientific (2 mentions)
Superscript 4 first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
Taqman primer, by Thermo Fisher Scientific (2 mentions)
Dnase 1, by Qiagen (2 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Ab4729, by Abcam (2 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Normal rabbit igg, by Fortis Life Sciences (2 mentions)
P120 101, by Fortis Life Sciences (2 mentions)
Perfecta sybr green supermix with rox, by Quanta Biosciences (2 mentions)
Taqman mirna probes, by Thermo Fisher Scientific (1 mentions)
Trzol reagent, by Thermo Fisher Scientific (1 mentions)
Hiseq x ten, by Illumina (1 mentions)
Tri reagent, by Thermo Fisher Scientific (1 mentions)
26 protocols using abi steponeplus machine
1
Quantifying Rapeseed Bee Pollen miRNAs
2
Quantitative PCR Analysis of Liver mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from liver tissues using TRZOL reagent (Invitrogen, USA). RNA was precipitated with isopropanol and dissolved in diethyl pyrocarbonate-treated distilled water. First strand cDNA was generated by reverse transcriptase master mix (TaKaRa, Japan). Quantitative PCR reactions comprised a final volume of 20 μL, containing 1 μL of cDNA, 10 nM of forward and reverse primers, and PCR master mixture (TaKaRa, Japan). qPCR was performed in 96-well plates using an ABI Stepone Plus machine (Applied Biosystems, USA). Average gene Ct values were normalised against the housekeeping gene GAPDH. Fold differences were determined using the comparative Ct method. The primer sequences were shown in Table 1 .
3
Transcriptome analysis of mib1-3 mutant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Shoot buds (2 weeks after germination) and the young pods (2 days after pollination) of WT and mib1-3 mutants were collected with three biological replicates. RNA was extracted by the RNA Kit R6827-01 (Omega, Shanghai, China). We performed RNA-seq using the Illumina HiSeq X Ten platform (Illumina, San Diego, California, USA). The raw sequences were submitted to the NCBI SRA database with accession numbers SRR16944233–SRR16944244. Number of reads per kilobase of exon region in a gene per million mapped reads (RPKM) was used to value expression levels (Mortazavi et al., 2008 (link)), and VC1973A version 1.0 was used as the reference genome (Kang et al., 2014 (link)). Based on the methods described by Audic and Claverie (1997) (link), DEGs were identified. Heat maps were generated by the pheatmap package (https://cran.r-project.org ).
For qRT-PCR, the first strand cDNA was synthesized via Takara PrimeScript™ RT reagent Kit RR047A (TaKaRa, Dalian, China). qRT-PCR analysis was conducted using TB Green™ Premix Ex™ RR420A (TaKaRa) and the ABI StepOnePlus machine (Applied Biosystems, Foster City, CA, USA). Three biological replicates with three technical repeats were conducted.
For qRT-PCR, the first strand cDNA was synthesized via Takara PrimeScript™ RT reagent Kit RR047A (TaKaRa, Dalian, China). qRT-PCR analysis was conducted using TB Green™ Premix Ex™ RR420A (TaKaRa) and the ABI StepOnePlus machine (Applied Biosystems, Foster City, CA, USA). Three biological replicates with three technical repeats were conducted.
4
Quantitative RT-PCR of Neuronal Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantitative real-time polymerase chain reaction (qRT-PCR), total RNA was isolated from freshly dissected neurons from CA3 and CA1 with the TRI Reagent (Life technologies), and RNA was reverse transcribed by using Moloney murine leukaemia virus reverse transcriptase (ImProm-II Reverse transcription system; Promega). For quantification of mRNA, real-time PCR was performed by using SYBR Green Master mix (TAKARA) and ABI step one plus machine (Applied Biosystems). The sequences of the forward and reverse primers for rat scip and ka1 pairs were F; 5′-tccctttctcttcccctctc-3′, R;5′-ggctctggtaaaacgaaacg-3′ and F;5′-gctccagcatgaccttcttc-3′, R;5′-ccctcctctgtgctcttcac-3′ and mouse scip and ka1 pairs were F; 5′-agttcgccaagcagttcaag-3′, R;5′-tggtctgcgagaacacgtta-3′ and F;5′-aatgggtttcagcagattgg-3′, R;5′-accagggtggtgttgaagag-3′.
5
HASMC Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA extracted and converted from purified RNA of HASMCs was employed to determine the mRNA expression of the specific genes. The ABI StepOnePlus machine and SYBR Green kit (Applied Biosystems) were employed in the real-time PCR assay. The primers employed in the experiments included NLRP3 (positive: 5′- GATCTTCGCTGCGATCAACA-3′; negative: 5′- GGGATTCGAAACACGTGCATTA-3′), OPN (positive: 5′-GGACAGCCAGGACTCCATTG-3′; negative: 5′-TGTGGGGACAACTG GAGTGAA-3′), OCN (positive: 5′-GTGACGAGTTGGCTGACC-3′; negative: 5′-CAAGGG GAAGAGGAAAGAAGG-3′), ALP (positive: 5′-CTCCCAGTCTCATCTCCT-3′; negative: 5′-AAGACCTCAACTCCCCTGAA-3′) and GAPDH (positive: 5′-AGGTGAAGGTCGGAG TCAAC-3′; negative: 5′-CCATGTAGTTGAGGTCAATGAAGG-3′) genes. The GAPDH gene expression was indicated as the internal control.
6
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the naive and soraR cells under various treatment conditions as above. cDNA was synthesized using Superscript III First-Strand Synthesis System kit (Invitrogen, Carlsbad, CA) as per the manufacturer’s instructions. qPCR analysis was performed as described [42 (link)] using SYBR Green PCR Master Mix (Applied Biosystems) in ABI StepOnePlus machine (Applied Biosystems). The PCR cycling condition was set as: an initial denaturation step at 95 °C for 2 min, 40 cycles at 95 °C for 15 s, 60 °C for 1 min finally subjecting to melting temperature to check the amplification curve. The relative changes in gene expression were estimated using the 2–ΔΔCt method using 18S rRNA as a housekeeping gene. The lists of primers used are included in Supplementary Table S1 .
7
Reanalysis of SLC2A Gene Expression in LUAD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We reanalyzed our prior projected SLC2A3, SLC2A6, SLC2A9, and SLC2A14 expression level results, including paired tumor and surrounding tissues from 6 primary LUAD patients diagnosed in The First Hospital of Jilin University from June 2021 to June 2022, to see if the mRNA expressions of SLA2As are parallel to those in clinical samples. A TRIzol-based (Invitrogen) technique was used to extract the RNA, and RT EasyTM (with gDNase) was used to create complementary deoxyribonucleic acid (FORE GENE). On an ABI StepOnePlus machine from Applied Biosystems, using the Power q-PCR SYBR Green Mix, all PCRs were run in triplicate (Yeasen). Using the Cttechnique, the relative mRNA expression of several genes was measured. One of the housekeeping genes was GAPDH. The additional information included a list of the primer sequences (Comate Bioscience) (Table 1 ). We calculated relative gene expression levels with 2−ΔΔCT, visualizing data with Graphpad 9.0.
8
Quantitative gene expression analysis in plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from 10-day-old seedlings and tissues from 30-day-old hydroponic plants using RNeasy mini kit (Qiagen, Valencia, CA, USA). Hydroponic propagation was described by Gibeaut et al. [52 (link)]. Complementary DNA (cDNA) was synthesized using SuperScript III reverse transcriptase (Invitrogen, Grand Island, NY, USA) from 1 μg of total RNA as suggested by the manufacturer. Quantitative PCR (qPCR) was performed in optical 96-well plates using an ABI StepOnePlus machine (Applied Biosystems, Grand Island, NY, USA). Each 10-μL reaction consisted of GoTaq qPCR Master Mix (Promega, Madison, WI, USA), 2 μL of 1:50 diluted cDNA, and 0.2 mM each of gene-specific primer pairs (see Table S1 ). The following thermal profile was used for qPCR: 95 °C for 2 min; 30 cycles of 95 °C for 15 s and 60 °C for 1 min; and a melt curve analysis at 95 °C for 15 s, 60 °C for 15 s, and 95 °C for 15 s. CT and standard curve were extracted using ABI StepOne v2.2 software (Grand Island, NY, USA). The fold change of gene expression and standard deviations were calculated according to the guide from ABI (http://www.appliedbiosystems.com/absite/us/en/home/support/tutorials.html , accessed on 6 April 2023). Melt curve analyses were used to verify that a single product was produced from each qPCR.
9
Quantitative Real-Time PCR Analysis of Epithelial-Mesenchymal Transition Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells using TRIzol reagent (TaKaRa). Reverse transcription was performed using the PrimeScript™ RT Reagent Kit (TaKaRa) and gDNA Eraser (Perfect Real Time) according to the manufacturers’ instructions. Quantitative real-time PCR (qPCR) was performed using the SYBR Premix Ex Taq (Tli RNase H Plus) system on an ABI Step One Plus machine (Applied Biosystems). The experiments were performed in triplicate, and the values were normalized to that of GAPDH. For absolute qPCR, the standard curves were generated using coding regions of SNAI1, SNAI2 and JUNB as described by Denzler et al. (22 (link)). The primer sequences are as follows: ETS2 qPCR fwd, CCCCTGTGGCTAACAGTTACA; ETS2 qPCR rev, AGGTAGCTTTTAAGGCTTGACTC; HNF4A qPCR fwd, CACGGGCAAACACTACGGT; HNF4A qPCR rev, TTGACCTTCGAGTGCTGATCC; JUNB qPCR fwd, ACAAACTCCTGAAACCGAGCC; JUNB qPCR rev, CGAGCCCTGACCAGAAAAGTA; FOXP1 qPCR fwd, TGGCATCTCATAAACCATCAGC; FOXP1 qPCR rev, GGTCCACTCATCTTCGTCTCAG; CDH1 qPCR fwd, TCAGGCGTCTGTAGAGGCTT; CDH1 qPCR rev, ATGCACATCCTTCGATAAGACTG; CDH2 qPCR fwd, ACAGTGGCCACCTACAAAGG; CDH2 qPCR rev, CCGAGATGGGGTTGATAATG; SNAI1 qPCR fwd, GGCCCACCTCCAGACCCACT; SNAI1 qPCR rev, GCGGGGACATCCTGAGCAGC; SNAI2 qPCR fwd, TGTGACAAGGAATATGTGAGCC; SNAI2 qPCR rev, TGAGCCCTCAGATTTGACCTG; GAPDH qPCR fwd, GAGTCAACGGATTTGGTCGT; GAPDH qPCR rev, GATCTCGCTCCTGGAAGATG.
10
Zika Virus Infection in Aedes Mosquitoes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Four-six day old female Ae. aegypti (Galveston strain) mosquitoes were orally infected with ZIKV (Mex 1–7 strain) at 2 x 105 focus forming units (FFU)/ml) in a sheep blood meal (Colorado Serum Company). At 2, 7 and 14 days post-infection (dpi) RNA was extracted from whole mosquitoes using the mirVana RNA extraction kit (Life Technologies) following the protocol for extraction of total RNA. Viral infection in mosquitoes was confirmed by Taqman qPCR on ABI StepOnePlus machine (Applied Biosystems) using a ZIKV-specific probe and primers (S4 Table ). RNA from ZIKV positive samples was pooled (N = 5) for time points 7 and 14. Limited ZIKV positive samples were detected at day 2, likely due to the virus titer being at the limits of detection for qPCR. For this time point, at least 1 qPCR positive individual was included in each pool. For all time points, three independent pools were used to create libraries for infected and uninfected samples. Control mosquitoes were fed with blood devoid of ZIKV and collected at the same time points and processed in the same way as infected ones.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!