Pvl1392 vector
The PVL1392 vector is a plasmid designed for the expression of recombinant proteins in bacterial hosts. It features a T7 promoter, a multiple cloning site, and an antibiotic resistance marker for selection. The core function of this vector is to facilitate the cloning and expression of target genes in a controlled and efficient manner.
Lab products found in correlation
3 protocols using pvl1392 vector
Baculovirus Protein Expression System
Production and Purification of Recombinant Rspo1 and HGF
Recombinant Rspo1 and HGF were expressed in Sf9 insect cells using the baculovirus expression system (BaculoGold; BD Pharmingen) and purified to homogeneity from the serum-free supernatant of Sf9 cells infected with their respective viral stocks (multiplicity of infection, 2 × 108/ml) by Talon metal affinity chromatography (BD Clontech). Endotoxin levels of these isolated recombinant proteins were <0.1 U/mg of proteins measured by limulus amebocyte lysate (LAL) from Cape Cod. Eluted proteins were dialyzed into PBS buffer.
Baculovirus Expression of Codon-Optimized Des7p
Each construct was co-transfected with the Baculogold Bright AcMNPV genome, according to BD Biosciences protocols. For control purposes, a recombinant baculovirus was constructed using solely the pVL1392 transfer vector (C). The constructs were checked with primers flanking the recombination site. (Forward: 5 0 TCCGGATTATTCATACCGTCCCACCATC 3 0 and Reverse: 5 0 GCTTCATCGTGTCGGGTTTAACATTACGG 3 0 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!