The largest database of trusted experimental protocols

Pvl1392 vector

Manufactured by BD
Sourced in United States

The PVL1392 vector is a plasmid designed for the expression of recombinant proteins in bacterial hosts. It features a T7 promoter, a multiple cloning site, and an antibiotic resistance marker for selection. The core function of this vector is to facilitate the cloning and expression of target genes in a controlled and efficient manner.

Automatically generated - may contain errors

3 protocols using pvl1392 vector

1

Baculovirus Protein Expression System

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA sequences coding for Pgm, Ku70a and Ku80c were obtained by gene synthesis (DNA 2.0 or Eurofins MWG/Operon). The synthetic PGM DNA sequence was first cloned into the pMAL-c2x vector (New England Biolabs). The MBP-PGM fusion, the MBP, the KU70a and the KU80c sequences were further introduced into the pVL-1392 vector (BD Biosciences). A HA tag was added to the C-terminus of Ku70a and the N-terminus of Ku80c. All plasmid sequences are provided in a supplementary information file (Text S1). Plasmids pVL1392-MBP-PGM, pVL1392-MBP, pVL1392-KU70a-HA and pVL1392-HA-KU80c were transfected individually into High Five cells together with the BD BaculoGold Linearized Baculovirus DNA (BD Biosciences).
+ Open protocol
+ Expand
2

Production and Purification of Recombinant Rspo1 and HGF

Check if the same lab product or an alternative is used in the 5 most similar protocols
The recombinant Rspo1 proteins (rRspo1) and HGF proteins (rHGF) are as previously described16 (link). Basically, the complimentary DNAs (cDNAs) of human Rspo1 and HGF were amplified for the construction of 6-His fusion proteins, using the forward primer for Rspo1: 5′-TTGCGGCCGCATGCGGCTTGGGCTGTG-3′, and the reverse primer for Rspo1: 5′-GGGAATTCGGCAGGCCCTGCAGATGTGAGTGGCC-3′; the forward primer for HGF: 5′-TTGCGGCCGCATGTGGGTGACCAAACTCC-3′, and the reverse primer for HGF: 5′-GGGAATTCTGACTGTGGTACCTTATATG-3′. The inserts of Rspo1 and HGF were digested with NotI/EcoRI. They were ligated into the pVL1392 vector (BD Pharmingen).
Recombinant Rspo1 and HGF were expressed in Sf9 insect cells using the baculovirus expression system (BaculoGold; BD Pharmingen) and purified to homogeneity from the serum-free supernatant of Sf9 cells infected with their respective viral stocks (multiplicity of infection, 2 × 108/ml) by Talon metal affinity chromatography (BD Clontech). Endotoxin levels of these isolated recombinant proteins were <0.1 U/mg of proteins measured by limulus amebocyte lysate (LAL) from Cape Cod. Eluted proteins were dialyzed into PBS buffer.
+ Open protocol
+ Expand
3

Baculovirus Expression of Codon-Optimized Des7p

Check if the same lab product or an alternative is used in the 5 most similar protocols
The DNA sequence of Des7p (TTHERM_00310640) was codonoptimized for baculovirus expression, synthesized and cloned in the pVL1392 vector (BD Bioscience, San Diego, CA, USA) by Gen-Script (Piscataway, NJ, USA) to obtain DES7i (i.e., a codon-optimized insect version of Des7p) and DES7i-His-Tag. The latter was synthesized by adding a 6xHis-tag coding sequence at the C-terminal end of the gene, prior to the stop codon. The DES7i and DES7i-His-Tag genes were cloned using the added Pst1 and BamH1 cloning sites, which rendered the constructs pVL1392-DES7i and pVL1392-DES7i-His-Tag, respectively.
Each construct was co-transfected with the Baculogold Bright AcMNPV genome, according to BD Biosciences protocols. For control purposes, a recombinant baculovirus was constructed using solely the pVL1392 transfer vector (C). The constructs were checked with primers flanking the recombination site. (Forward: 5 0 TCCGGATTATTCATACCGTCCCACCATC 3 0 and Reverse: 5 0 GCTTCATCGTGTCGGGTTTAACATTACGG 3 0 ).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!