Total cellular RNA was isolated from cells using the total RNA extraction kit or manually using trizol (Geneall, Korea). qRT-PCR was done using a real time PCR system (Applied Biosystems: 1 cycle at 50°C for 2 min & 95°C for 10 min; 40 cycles at 95°C for 15 s & 60°C for 1 min). Glyceraldehyde 3-phosphate dehydrogenase was used as a control for cDNA loading and PCR. PCR primers were synthesized by M-biotech Inc. (Korea). Cav1.3 PCR primers were targeted to exon 21–22 (# Mm.PT.47.16004990).
Trizol
Manufactured by GeneAll
Sourced in Cameroon, United States
Trizol is a reagent used in molecular biology laboratories for the extraction and purification of RNA from various types of biological samples. It is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components that facilitate the isolation of total RNA, including small RNA species, from cells and tissues.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rna protection reagent, by Qiagen (1 mentions)
Nanodrop, by Eppendorf (1 mentions)
Topreal qpcr 2x premix sybr green with low rox, by Enzynomics (1 mentions)
Rg 6000 thermocycler, by Qiagen (1 mentions)
Triton x 100, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Novaseq 6000, by Illumina (1 mentions)
Mini beadbeater, by Biospec (1 mentions)
Rq1 rnase free dnase, by Promega (1 mentions)
Miracloth, by Merck Group (1 mentions)
Sybr green reagent, by Enzynomics (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
Colibri spectrometer, by Berthold Technologies (1 mentions)
Hybrid rtm kit, by GeneAll (1 mentions)
Accupower cyclescript rt premix, by Bioneer (1 mentions)
10 protocols using trizol
1
Quantitative RNA Expression Analysis
2
RNA Isolation and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For in vivo experiments, excised tissues were stored at −80 °C in 1 mL tubes containing RNA protection reagent (Qiagen, Hilden, Germany). For RNA isolation, 50–100 mg tissue was homogenized in 1 mL Trizol (Gene All, Seoul, Republic of Korea, RiboEx, cat. no. 301–001). RNA extraction procedures were performed according to the manufacturer’s recommendations. RNA samples were treated with DNase I to minimize genomic DNA contamination, and RNA integrity and quantity were confirmed by agarose gel electrophoresis and NanoDrop (Eppendorf, Tokyo, Japan, BioSpectrometer). cDNA was synthesized from 1–5 µg total RNA using reverse transcriptase with random hexamer primers (Enzynomics, Daejeon, Republic of Korea, TOPscriptTM cDNA Synthesis Kit, cat. no. EZ005S).
3
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol (GeneAll Biotechnology CO., LTD, Korea) used to extract total RNA according to the manufacturer’s instructions. After obtaining the quantitative and qualitative analysis of RNA with the Spectrophotometer (DeNovix Inc., USA), complementary DNA (cDNA) was synthesized using 2X RT-PCR Pre-Mix Taq cDNA synthesis kit (BioFact,Korea).
4
RNA Isolation and qPCR Analysis of FGF Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the tissue samples of dorsal skin or HDPs with Trizol™ (GeneAll Biotechnology, Seoul, South Korea). The cDNA was generated from 1 µg of total RNA using Topscript™ Reverse Transcription System (Enzynomics, Inc., Daejeon, South Korea) following the manufacturer’s protocol. PCR was performed with TOPreal™ qPCR 2X Pre Mix (SYBR Green with low ROX, Enzynomics, Inc., Daejeon, South Korea) using Rotor Gene Q instrument (Corbett Research, Mortlake, Australia) at 95 °C for 5 min, followed by 25–30 cycles of 95 °C for 30 s, 60 °C for 1 min, and 75 °C for 1 min. The following primer sets were used: mFGF-7, forward 5rwCCCTTTGATTGCCACAATTC-3CTand reverse 5veTTGACAAACGAGGCAAAGTG-3G; mFGF-5, forward 5′-CGCGGACGCATAGGTATTAT-3CGand reverse 5veACGAGGAGTTTTCAGCAACAA-3G; mGAPDH, forward 5rwGGAGCCAAAAGGGTCATCAT-3AGand reverse 5veGTGATG GCATGGACTGTGGT-3A; hFGF-7, forward 5′-GACATGGATCCTGCCAACTTGGGCTGGAACAGTTCACATT-3CAand reverse 5veGGGCTGGAACAGTTCACATT-3G; hFGF-5, forward 5′-CTTGGAGCAGAGCAGTTTCC-3TGand reverse 5veCTTCGTGGGATCCATTGACT-3T; hGAPDH, forward 5rwAGGGCTGCTTTTAACTCTGGT-3GGand reverse 5veCCCCACTTGATTTTGGAGGGA-3C.
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tumour content of RNA was extracted using Trizol (GeneAll, Korea), which was subjected to quality and quantity assessments using agarose gel visualization and measuring the A260/A280 ratio (NanoDrop 1000 Spectrophotometer, Wilmington, DE, USA). Complementary DNA was generated using Two‐Strand Synthesis kit (General, Korea), and gene expression analysis was performed using real‐time PCR. Each PCR cycle included a 10‐s denaturation phase at 95°C, followed by a 10‐s annealing step at 55–62°C and a 30‐s extension phase at 72°C. Each PCR reaction contained template cDNA (1 μL), specific pairs of primers (1 μL), deionized water (10.5 μL) and SYBR® Green Master Mix‐Plus (Yektatajhiz, Iran) (12.5 μL) performed in Corbett RG6000 thermocycler (Australia). GAPDH was employed as the internal control gene, and the Rotor‐Gene 6000 Series Software was used to calculate the cycling threshold (CT) (Table 1 ). The CT (Cq) obtained was adjusted according to the respective value obtained for the internal control gene using the following formula: Cqtarget − CqGAPDH = ΔCq. Finally, 2(−ΔΔCq) formula was used to calculate gene expression in the sample (Livak & Schmittgen, 2001), where ΔΔCq = ΔCqtarget – ΔCqcontrol.
6
Cloning and Characterization of Dicentracin-like Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from Asian sea bass fish with Trizol (GeneALL, Korea) and the first chain complementary deoxyribonucleic acid (cDNA) was synthesized according to the manufacturer’s instructions (Thermo, Life Sciences). Dicentracin-like coding gene ( XM_018688317.1 ) was amplified using the specific forward (5- ATA GGA TCCATGAAGTGTGTTATGCTTTTTC -3 ) and reverse (5- ATA CTC GAGTCAAAATGAGGCCTGATAATC-3 ) primers that were designed using Gene Runner software on the basis of dicentracin-like gene sequences(XM_018688317.1 ). After amplification of the gene, PCR product was extracted from agarose gel and digested with BamH1/Xho1 enzymes, and inserted in BamH1/Xho1 sites in the pET28b vector. E.coliDH5α cells were transformed ligated plasmid and colony containing recombinant plasmid was selected by the colony PCR method using T7 universal primers. Then the recombinant plasmid was extracted and the inserted DNA was sequenced (Source: BioScience, UK).
7
Transcriptomics of A. fumigatus wild-type and ΔsscA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the transcriptomic study of A. fumigatus WT and ΔsscA conidia, each strain was streaked onto solid MMY and grown at 37 °C for 2 days. Conidia of each strain were then suspended with 0.02% Triton X-100 (Thermo Scientific, USA) and filtered with Miracloth (Merck, USA).
Total RNA extraction was performed as previously described (Son and Park 2020 (link)). All samples were isolated using a Mini-bead beater (BioSpec Products Inc., USA) and TRIzol (GeneAll Biotechnology, Republic of Korea), and the extracted RNA samples were dissolved in diethylpyrocarbonate (DEPC)-treated water (Bioneer, Republic of Korea). Total RNA was treated with RQ1 RNase-free DNase (Promega, USA) and purified using the RNeasy Mini Kit (Qiagen, Germany). RNA sequencing was performed by Theragen Bio (Suwon, Republic of Korea). Briefly, three biological replicates of each strain were sequenced on Illumina Novaseq 6000, and reads were annotated with the A. fumigatus AF293 transcriptome using the aligner STAR v.2.3.0e software. The DESeq2 method was used for evaluating and normalising differentially expressed genes (DEGs). DEGs were screened with |log2(fold change)| ≥ 1 and p value < 0.05, and gene ontology (GO) analyses were performed using the R package and FungiDB database.
Total RNA extraction was performed as previously described (Son and Park 2020 (link)). All samples were isolated using a Mini-bead beater (BioSpec Products Inc., USA) and TRIzol (GeneAll Biotechnology, Republic of Korea), and the extracted RNA samples were dissolved in diethylpyrocarbonate (DEPC)-treated water (Bioneer, Republic of Korea). Total RNA was treated with RQ1 RNase-free DNase (Promega, USA) and purified using the RNeasy Mini Kit (Qiagen, Germany). RNA sequencing was performed by Theragen Bio (Suwon, Republic of Korea). Briefly, three biological replicates of each strain were sequenced on Illumina Novaseq 6000, and reads were annotated with the A. fumigatus AF293 transcriptome using the aligner STAR v.2.3.0e software. The DESeq2 method was used for evaluating and normalising differentially expressed genes (DEGs). DEGs were screened with |log2(fold change)| ≥ 1 and p value < 0.05, and gene ontology (GO) analyses were performed using the R package and FungiDB database.
8
Ovarian RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One frozen ovary from each mouse was placed in TRIzol® (GeneAll, #301-001) reagent. The remaining processes were carried out in accordance with the manufacturer's instructions. The quantity and quality of RNA were measured using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Carlsbad, CA, USA). The cDNA was synthesized from 1 µg of total RNA, random hexamers, using a commercial cDNA synthesis kit (Perma Tajhiz Azma, Iran). The mRNA expression was quantitated on the Rotor-Gene 3000 device using primers and RealQ Plus 2x Master Mix Green (Amplicon, Denmark), according to the manufacturer's protocol.
The RPLP0 endogenous gene was used as internal control, and gene expression levels were calculated using the 2-ΔΔCt method (Fu et al., 2010[15 (link)]). The primers were designed using the PRIMER3.0 program (http://bioinfo.ut.ee/primer3-0.4.0 ). The primer specificity was verified by using Primer blast tool from the NCBI genome browser. Table 1(Tab. 1) shows the primer sequences used for Real-time PCR assays.
The RPLP0 endogenous gene was used as internal control, and gene expression levels were calculated using the 2-ΔΔCt method (Fu et al., 2010[15 (link)]). The primers were designed using the PRIMER3.0 program (
9
Quantitative Analysis of UPR Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using Trizol (Gene All, Ribo-Ex, Seoul, Korea) and cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA, BR170-8891). The relative amounts of mRNAs were calculated from the comparative threshold cycle (Ct) values relative to 18s rRNA using CFX96 Real-Time PCR detection system (Bio-Rad, Hercules, CA, USA, 184-5384) with SYBR green reagent (Enzynomics, Daejeon, Korea, RT500M) according to manufacturer’s instruction. Real-time primer sequences used in this study were as follows: Chop (5′-CTG CCT TTC ACC TTG GAG AC-3′; 5′-CGT TTC CTG GGG ATG AGA TA-3′), sXBP1 (5′-GAG TCC GCA GCA GGT G-3′; 5′-GTG TCA GAG TCC ATG GGA-3′), total XBP1 (5′-AAG AAC ACG CTT GGG AAT GG-3′; 5′-ACT CCC CTT GGC CTC CAC-3′), Grp78 (5′-GGT GCA GCA GGA CAT CAA GTT-3′; 5′-CCC ACC TCC AAT ATC AAC TTG A-3′), Hsp70 (5′-TCG AGG AGG TGG ATT AGA GG-3′; 5′-GCA GCT ATC AAG TGC AAA GAG-3′).
10
Measuring Mct1 and Mct4 Expression in Gastrocnemius
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of Mct1 and Mct4 in the gastrocnemius collected after the treadmill experiment were measured. Total RNA was extracted using TRIzol (301-001, Geneall Biotechnology, Korea) as described in the manufacturer's instructions. This RNA was then further purified using a Hybrid-R TM kit (305-101, Geneall Biotechnology, Korea) and the total RNA concentration was determined using a Colibri Spectrometer (5410012212-2012 Titertek-Berthold, Germany). AccuPower® CycleScript RT PreMix (K-2047-B, Bioneer, South Korea) was used to produce cDNA according to the manufacturer's instructions, and amplified using a set of custom sequence-specific primers (Cosmogentech, South Korea): Mct1 forward (5'-TTG TCT GTC TGG CGG CTT GAT CG-3') and reverse (5'-GCC CAA GAC CTC CAA TAA CAC CAA TGC -3'); Mct4 forward (5'-ACG GCT GGT TTC ATA ACA GG -3') and reverse (5'-CCA ATG GCA CTG GAG AAC TT -3'). SYBR green reagent (SRH83-M40H, Solgent, South Korea) was used for the detection. The qRT-PCR reactions were performed in triplicate to evaluate Mct1 and Mct4. The cycling conditions were as follows: 95 ℃ for 15 min, 95 ℃ for 20 sec, 60 ℃ for 40 sec, 72 ℃ for 30 sec, and 95 ℃ for 15 sec. All results were analyzed using the ΔΔ Ct method Ct is defined as the threshold cycle.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!