Easypfu dna polymerase

The genomic DNA of each strain was extracted by the EasyPure genomic DNA kit (Transgen Biotech, Beijing, China, catalogue #EE101-01). The 16S rRNA gene was amplified by PCR using primers 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-TACGGTTACCTTGTTACGACTT-3′). The enzyme was EasyPfu DNA polymerase (Transgen Biotech, Beijing, China, catalogue #AP211-01). The amplified DNA fragments were sequenced by Sangon Biotech Inc. (Shanghai, China). The sequencing data were analyzed using Basic Local Alignment Search Tool (BLAST 2.3.0) (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and bacterial species were identified based on sequence identity from the database. Phylogenetic trees were constructed using neighbor-joining method and Kimura two parameter model in MEGA 5.1 program (Kumar et al. 2008 (link)).

Sodium alginate was purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Standard alginate oligosaccharides, from disaccharide to octasaccharide, were purchased from QINGDAO HEHAI BIOTECH Co., Ltd. (Qingdao, China). Ni-NTA His·Bind Resin was purchased from EMD Millipore Corp (Burlington, MA, USA). EasyPfu DNA polymerase and EasyPure genomic DNA kit were purchased from Transgen Biotech (Beijing, China). Other chemicals and reagents used in this study were of analytical grade.

RNA from yeast-carrying DGAT1 genes and mutants was extracted using a yeast RNA extraction kit (Kangwee Century, Beijing, China), and cDNA was prepared from 5 μg total RNA template using ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan). Yeast actin was selected as the reference gene, and expression of CeDGAT1 mutants was analyzed by RT-PCR using the primer pairs CeDGAT1yeast-f (5′AGTCGGTTCTGGGTGTTCA3′), CeDGAT1yeast-r (5′GCCTGAGTCGGAAGCATAGT3′), Actinyeast-f (5′ACGTCGCCTTGGACTTCGAA3′), and Actinyeast-r (5′AGATGGAGCCAAAGCGGTGA3′). The 25 μL final reaction volume used for PCR contained 2.5 μL of 10 × PCR buffer, 1 μL of each primer (10 μM), 2.0 μL of 2.5 mM dNTPs, 1 μL of cDNA sample, 0.5 μL of Easy-Pfu DNA polymerase (TransGen Biotech, Beijing, China), and 17 μL of double-distilled water. The reaction conditions for PCR were as follow: Denaturation at 95 °C for 10 min, followed by 30 cycles of 94 °C for 30 s, 60 °C for 30 s, and 72 °C for 20 s; and a final extension step of 72 °C for 10 min. The amplified cDNA was cloned into the pEASY-Blunt vector (TransGen Biotech, Beijing, China), and the corresponding clones were verified by PCR and DNA sequencing.

In a previous study, digital gene expression (DGE) analysis of G. aridum under salt stress revealed that the expression levels of 28 of 109 WRKY genes were significantly altered under salt stress. Using gene-specific primers (S2 Table) designed based on corresponding homologous gene in the G. raimondii genome, WRKY genes were cloned by PCR and their transcripts were amplified from G. aridum roots treated with 200 mM NaCl for 12 hours. PCR was performed using EasyPfu DNA Polymerase (TransGen Biotech, China). The PCR products were cloned into the PTG19-T vector (TransGen Biotech, China) and sequencing was performed by Invitrogen (Shanghai, China). The subcellular localizations of proteins were predicted by CELLO v.2.5 (subcellular localization predictor, http://cello.life.nctu.edu.tw) [39 (link)].