Mcrbc enzyme

WT and msa1-1 plants were grown on MGRL media with 1500 μM (+S) or without (-S) sulphate for two weeks. The genomic DNA was extracted from shoots and roots using a DNeasy Plant Mini Kit (Qiagen). One microgram genomic DNA was mixed with restriction buffer and then split into 2 × 50 μL with either 2 μL McrBC enzyme (New England Biolabs) or 2 μL 2% (v/v) glycerol as nondigested control. After overnight digestion and deactivation, a standard PCR was performed using the primers to amplify the promoter sequence of SULTR1;1. EF-1α (AT5G60390) was used as a negative control. The primer sequences used for PCR are listed in S9 Table.

Genomic DNA from ‘Pokkali’ and ‘IR29’ leaves was isolated as referred above. Genomic DNA (1.5 μg) was digested overnight at 37°C with 25 units of McrBC enzyme (New England Biolabs) in a final volume of 50μl following the manufacturer’s instructions. Digested and negative control samples were subjected to PCR amplification to detect the methylation status of eight selected transposable elements (TE-I_Os04g19320, TE-I_Os04g17620, TE-II_Os04g087100, Chr3-AnacA2_TE, Chr8-Tnr8_TE, Chr9-Ty3/gypsy_TE, Chr12-centromeric-like_LTR, Tos17), one repetitive sequence (Telomere_repetitive seq), four selected salt-stress responsive genes (OsRMC, OsHKT5; OsSalT, OsNHX1) and two constitutively expressed genes (eEF, OsActin). The primers were designed with NCBI software (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). The sequences are indicated in the S2 Table.

Neonatal mouse forebrain was dissected, rinsed in 37°C Dulbecco's modified Eagle's medium (DMEM) (Sigma-Aldrich) and passed through a 70-μm cell strainer (BD Falcon) to ensure single cell suspension. The cell suspension was incubated at 37°C for 30 min to equilibrate. Cells were fixed in 1% formaldehyde (Sigma-Aldrich) for 5 min and rinsed three times with cold PBS containing protease inhibitors (Roche Diagnostics). Cells were resuspended in lysis buffer [0.34 M sucrose, 60 mM KCl, 15 mM Tris–HCl, 15 mM NaCl, 0.5% NP-40 and 1× protease inhibitors (Sigma-Aldrich)] and flash-frozen and thawed three times, nuclei were centrifuged and resuspended in micrococcal nuclease digestion buffer (NEB). Micrococcal nuclease (2 U; NEB) was added and incubated at 37°C for 5 min, then quenched with EDTA. Cells were lysed with 1% SDS and cross-links reversed by incubation at 65°C for 5 h, followed by RNAse and PK digestion and phenol/chloroform extraction. DNA was subsequently digested with McrBC enzyme (NEB) for 2 h at 37°C. DNA was amplified in duplicate with iQ™ SYBR^® Green master mix (BioRad) on a Chromo-4 thermocycler (MJ Research) using the following conditions: 35 cycles of 95°C for 30 s, 57.5°C for 30 s, and 72°C for 1 min. Quantification was achieved using the Ct method of quantification and normalized to amplification of Gapdh and Beta-actin.

The analysis is based on previously described method[35 (link)]. Genomic-DNA was extracted using NucleoSpin Tissue kit (Macherey-Nagel). 500ng of genomic-DNA was digested in 30μl reaction using McrBC enzyme (NEB) for 3h at 37°C and hit-inactivated at 65°C for 20min. As a control, parallel reaction without McrBC was performed. The restriction products diluted to 90μl and 5μl served as a temple for Real-time PCR analysis with primers surrounding the CpG island promoter region. Product could be amplified only if there was no restriction, meaning all the amplicon was unmethylated. qPCR was performed using PerfeCTa SYBR Green SuperMix (Quantabio) with the following conditions: 2min 50°C, 10min 95°C, 45 cycles of 15sec 95°C, 1min 65°C. Primers used are CCCCGAGACTCTGGTACTGT and GAGTCCGCGCGAGATGG.

Genomic DNA samples (500 ng each) were digested for 2 h at 37 °C with 30 U of McrBC enzyme (NEB). A mock digestion was performed in parallel with no enzyme. Then, 5 ng DNA from each sample was used for PCR analysis. DNA was extracted using a Plant Genomic DNA Kit (TIANGEN, China).

Sodium butyrate (NaBu), trichostatin A (TSA), cambinol (Cmb), and 5-aza-2′-deoxycytidine (AZA) were purchased from Sigma-Aldrich (#303410, #T8552, #C0494, and #A3656) and dissolved in phosphate-buffered saline (PBS) to final concentrations of 2 mM, 0.1 μM, 0.2 μM, and 15 mM in the fishes’ water, respectively. PBS alone was used as vehicle control. The pharmacological treatment lasted for 24 h from 7 to 8dpf. Acetyl-histone 4 and acetyl-lysine antibodies were obtained from Millipore (#06-866 and #05-515), anti-HDAC1 and anti-YY1 from ActiveMotif (#39531 and #61780), anti-Sp1 and anti-H4 from Abcam (ab59257 and ab16483), and McrBC enzyme from New England Biolabs (M0272).