Fas promoter activity was assessed in SW620 cells using the commercial LightSwitch Luciferase Assay system (Active Motif, Carlsbad, CA), according to the manufacturer’s instructions. Relative Luciferase Units (RLU) were assessed in a Luminometer and normalized using a positive (pLightSwitch-GAPDH-prom) and a negative (pLightSwitch-EMPTY-prom) control vector (both from Active Motif).
Lightswitch luciferase assay system
Manufactured by Active Motif
Sourced in United States
The LightSwitch Luciferase Assay system is a bioluminescent reporter gene assay kit designed for the quantitative measurement of gene expression in live cells. The system utilizes a luciferase reporter gene that emits light when activated, allowing for the detection and quantification of transcriptional activity.
Automatically generated - may contain errors
Lab products found in correlation
6 protocols using lightswitch luciferase assay system
1
Fas Promoter Activity Quantification
2
Comparative Luciferase Assay of SEC Protein Secretion Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa Kyoto cells were grown in 96-well plates for 24 h in complete medium at 37°C in 5% CO2. Luciferase assays were performed with the following promoter luminescent reporter gene constructs: SEC23A, SEC23B, SEC24B, SEC24C, SEC24D, and GAPDH (Active Motif). All promotor constructs were obtained from the Active Motif LightSwitch Promoter Reporter GoClone Collection (Trinklein et al., 2003 (link)). Cells were cotransfected with 50 ng GoClone plasmid DNA per well and with 10 ng of either turboGFP-tagged RNF11 or GFP empty vector according to the manufacturer’s instructions (Active Motif). Plasmid DNA expression time was 24 h for all experiments. Luciferase reporter signal was measured with the LightSwitch Luciferase Assay System (Active Motif) on a SpectraMax L luminometer according to the manufacturer’s instructions. Relative luminescence units of GFP-expressing cells were normalized to RNF11-GFP–expressing cells. To achieve this, in parallel to the 96-well plate for the luciferase assay, a 96-well glass-bottom plate was assessed on a standard wide-field fluorescence microscope for the transfection efficiency of cells with GFP or RNF11-GFP in each well. Relative luminescence units measured in the wells of GFP-expressing cells were then corrected for the higher expression efficiency (on average 1.5-fold higher) compared with RNF11-GFP–expressing cells.
3
Luciferase Assay for miRNA Target Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this assay, a plasmid containing the wild-type (wt) or mutated (Mut) 3′UTR cloned downstream to a luciferase reporter gene was co-transfected with a mimic of miR-203a-3p or a control miRNA, which did not target any human mRNA.
The SwitchGear GoClone 3′UTR reporter vector (Active Motif, Carlsbad, CA, USA) containing or not a mutation in the miR-203a-3p putative binding site (100 ng) along with either the LightSwitch miR-203a-3p mimic (50 nM, GUGAAAUGUUUAGGACCACUAG) or the LightSwitch non-targeting control (50 nM, UCACAACCUCCUAGAAAGAGUAGA, # MIM9001) were co-transfected in a Hela cell line at 80% confluence, using 0.15 µl of Dharma-FECT DUO transfection reagent (Dharmacon). Each construct was transfected in triplicate separately with either the miR-203a-3p mimic or the nontargeting control miRNA. 24h later, Luciferase reaction was performed for 30 min in the dark, followed by luminescence reading on a plate luminometer, according to the manufacturer’s protocol (LightSwitch Luciferase assay system, Active Motif, Carlsbad, CA, USA). Luminescence values were compared using the Student’s t-test.
The SwitchGear GoClone 3′UTR reporter vector (Active Motif, Carlsbad, CA, USA) containing or not a mutation in the miR-203a-3p putative binding site (100 ng) along with either the LightSwitch miR-203a-3p mimic (50 nM, GUGAAAUGUUUAGGACCACUAG) or the LightSwitch non-targeting control (50 nM, UCACAACCUCCUAGAAAGAGUAGA, # MIM9001) were co-transfected in a Hela cell line at 80% confluence, using 0.15 µl of Dharma-FECT DUO transfection reagent (Dharmacon). Each construct was transfected in triplicate separately with either the miR-203a-3p mimic or the nontargeting control miRNA. 24h later, Luciferase reaction was performed for 30 min in the dark, followed by luminescence reading on a plate luminometer, according to the manufacturer’s protocol (LightSwitch Luciferase assay system, Active Motif, Carlsbad, CA, USA). Luminescence values were compared using the Student’s t-test.
4
MSI1 Regulation of cMET Expression
5
MSI1 Regulation of cMET Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A Lightswitch Luciferase Assay System (Active Motif, Inc) was used for the assessment of MSI1 regulation of cMET. Briefly, 1×104 MIA PaCa-2 cells were plated into 96 well plates and cultured for 24 hours. 50ng of cMET 3'UTR GoClone (S811259, Active Motif, Inc) plasmid DNA and increasing concentrations (0ng, 50ng, and 100ng) of either PGK-GFP or PGK-MSI1 plasmid vector DNA were co-transfected into MIA PaCa-2 cells. After 24 hours, cells were lysed using the Lightswitch Luciferase Assay Reagent (LS100, Active Motif, Inc) and luciferase activity measured using a plate scanner (Infinite 200, Tecan).
6
Analyzing Transcription Factor Regulation
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!