Pet30b

The N-terminal domain (1–165 aa) of M1 was subcloned into pET30b (Novagen) from a pHW2000 plasmid expressing the full-length A/WSN/33 M1 [10] (link) at the cloning sites of Nde1+Xho1. The new plasmid pET30b-M1wt-1–165 with a His-tag at the N-terminus (5′-primer: actagccatatgcaccatcatcatcatcatagtcttctaaccgaggtc; 3′-primer: tctgatctcgagctacatttgcctatgagaccgatg) was expressed in E. coli strain Nico21(DE3) (NEB). The His-tagged N^1–165-domain of M1 was further purified by affinity chromatography in combination with FPLC columns (Excellgen, MD) with the purity>90% by SDS-PAGE analysis. The recombinant protein was kept in 55 mM KH₂PO₄/K₂HPO₄, 0.2 M NaCl, 2 mM TCEP buffer at pH 4.0.

The coding region of ompR was PCR amplified with primer sets GT336/GT337 (Table 2) and cloned into the NdeI/HindIII site in pET30b (Novagen, 205 Madison, Wis). The resulting plasmid pET30b-OmpR was then transformed into E. coli BL21(DE3) (New England Biolabs), and overproduction of the recombinant protein was induced by the addition of 0.1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for 4 h at 37°C. The recombinant proteins were then purified from the soluble fraction of the total cell lysate by affinity chromatography using His-Bind resin (Novagen, Madison, Wis). Finally, the purified proteins were dialyzed against GMS buffer (50 mM Tris-HCl, pH 7.5, 50 mM KCl, 10 mM MgCl₂, 0.5 mM EDTA, and 10% glycerol) at 4°C overnight, and the purity was determined by SDS-PAGE.

The gene sequence of PF0739 was amplified from genomic DNA of P. furiosus using primers with additional BamHI and NdeI restriction recognition sites. The PCR product was cloned into vector pET-30b (NEB) using the respective restriction sites. PF0739 protein variants lacking potential metal-sensing domains (ΔTRASH, ΔHIS, ΔHISΔTRASH) were based on the full-length plasmid version and ligated after amplification using one phosphorylated primer, respectively (see Supplementary Table 1). Subsequently, the constructs were transformed into E. coli DH5-α for amplification and grown on Kanamycin (50 μg/ml) supplemented LB media. Next, the constructs were transformed into E. coli BL21 STAR^TM (DE3) expression strain and grown on Kanamycin (50 μg/ml) supplemented LB medium at 37°C. Protein expression was induced by addition of 0.5 mM IPTG to the cell culture medium at an OD₆₀₀ of about 0.6. Cultures were further cultivated at 18°C overnight, before harvesting the cells by centrifugation at 10,000 g for 10 min at 4°C. Cells were stored at −80°C until protein purification.