Mceruleann1

Manufactured by Addgene

MCeruleanN1 is a fluorescent protein that emits blue-cyan fluorescence. It is derived from the Cerulean fluorescent protein and is designed for use in various biological and biochemical applications.

Automatically generated - may contain errors

Lab products found in correlation

β actin 4970, by Cell Signaling Technology (1 mentions) Pbi cmv1, by Takara Bio (1 mentions)

2 protocols using mceruleann1

Antibodies and Plasmids for Cellular Studies

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antibodies directed against HA (3724), ATP1A1 phospho-Ser¹⁶ (4020S), β-actin (4970S), polyclonal normal IgG (2729S), AMPK (2532), AMPK phospho-Thr¹⁷² (2535), pan Akt (4685S), Akt phospho-Thr³⁰⁸ (5056S), Akt phospho-Ser⁴⁷³ (4058), Src (2109S), Src phospho-Tyr⁴¹⁶ (2101), EGFR (4267), EGFR phospho-Tyr¹⁰⁶⁸ (8543S), p44/42 MAPK (Erk1/2) (4695), p44/42 MAPK (Erk1/2) phospho-Thr²⁰²/Tyr²⁰⁴ (4094S) and anti-Ki-67 (11882) were purchased from Cell Signaling Technology. Antibodies directed against c-myc-tag (MA1980) and ATP1A1 (MA3-928) were purchased from Thermo Fisher Scientific. The antibody directed against mouse normal IgG (sc-2025) was purchased from Santa Cruz Biotechnology. Pepducins and pNaktide were custom synthesised by Peptide 2.0 Inc.
The pEXPR-IBA 103 Strep-tag plasmid (2-3503-000) was purchased from IBA Life Sciences. HA tagged plasmids (GPR035TN00, CXCR20TN00 and CCR050TN00) were purchased from the cDNA Resource Centre. Plasmids for ATP1A1 (RC201009), ATP1A2 (SC119715) and ATP1A3 (RC203198) were purchased from Origene. mVenusN1 (27793) and mCeruleanN1 (27795) were purchased from Addgene. The HPSI0114i-kolf_2 (KOLF-2) (ECACC 77650100) iPSC cell line has previously established by the Wellcome Trust Sanger Institute. Other cell lines were purchased from ATCC.

Schneditz G., Elias J.E., Pagano E., Zaeem Cader M., Saveljeva S., Long K., Mukhopadhyay S., Arasteh M., Lawley T.D., Dougan G., Bassett A., Karlsen T.H., Kaser A, & Kaneider N.C. (2019). GPR35 promotes glycolysis, proliferation, and oncogenic signaling by engaging with the sodium potassium pump. Science signaling, 12(562), eaau9048.

+ Open protocol

+ Expand

Fluorescent Reporter Plasmid Construction

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The set of fluorescent reporters coding for eYFP and mCherry was obtained from Addgene (#31463, #31464, #31465, and #31466, deposited by Phil Sharp Lab) and are the same as those used in [17 (link)]. The second set of fluorescent reporters were cloned into pBI-CMV1 (Clontech). A nuclear localization sequence (NLS) (ATGGGCCCTAAAAAGAAGCGTAAAGTC) was appended to mCerulean-N1 (Addgene #27795, deposited by Steven Vogel Lab [57 (link)]) by PCR and then inserted into the main vector with ClaI and BamHI. mKOrange-NLS (Addgene #37346, deposited by Connie Cepko Lab [58 (link)]) was cloned into the vector using EcoRI blunt and BamHI. miR-20a regulatory elements were appended to the 3^′ UTR of mCerulean with the same strategy applied in [17 (link)]: the N=1 bulged miR-20 binding site (TACCTGCACTCGCGCACTTTA) was appended by PCR and for both constructs, CCGG spacers separate subsequent miR-20a regulatory elements.

Bosia C., Sgrò F., Conti L., Baldassi C., Brusa D., Cavallo F., Cunto F.D., Turco E., Pagnani A, & Zecchina R. (2017). RNAs competing for microRNAs mutually influence their fluctuations in a highly non-linear microRNA-dependent manner in single cells. Genome Biology, 18, 37.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!