Pjet plasmid

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PJET plasmid is a vector used for cloning and expressing genes in various host organisms. It provides a reliable and efficient platform for DNA manipulation and recombinant protein production. The PJET plasmid features a multiple cloning site, antibiotic resistance markers, and other essential elements required for basic molecular biology applications.

Automatically generated - may contain errors

Lab products found in correlation

High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions) Sybr green master mix, by Thermo Fisher Scientific (1 mentions) Aurum total rna mini kit, by Bio-Rad (1 mentions) Genomic mini kit, by A&A Biotechnology (1 mentions) Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions) Genejet plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions) Genejet gel extraction kit, by Thermo Fisher Scientific (1 mentions) Chromas lite, by Technelysium (1 mentions)

5 protocols using pjet plasmid

Recombinant Production of Der p 5 Allergen

Check if the same lab product or an alternative is used in the 5 most similar protocols

The complementary DNA insert of Der p 5 was generated by PCR using primers containing SnabI and AvrII restriction sites. The DNA insert was ligated into the pJET plasmid (Invitrogen) and transformed into DH5α-competent cells. The complementary DNA of Der p 5 was subcloned into the pPIC9K expression vector.
The expression vectors with Der p 5 insert were subsequently transformed into Pichia pastoris SMD 1168 cells for expression of proteins. Cells were grown in BMGY (with 100 μg/mL ampicillin) until A600 reached 6–10. Protein expression was then induced with 0.05% methanol in 1 L of BMMY at 28°C for 48 hours. Protein was further purified using a resin cation exchange SPFF followed by a second separation by an S100HR HiLoad 16/60 Superdex 75 pg (GE Healthcare) gel filtration column and HiTrap QHR on AKTA Fast Protein Liquid Chromatography System (GE Healthcare). Protein concentration was determined by bicinchoninic acid test.

Lahiani S., Dumez M.E., Bitam I, & Galleni M. (2018). Der p 5 allergen from house dust mite: first epitope mapping of rabbit IgG blocking antibodies. New Microbes and New Infections, 27, 69-74.

+ Open protocol

+ Expand

Quantification of Lactobacillus reuteri in Feces

Check if the same lab product or an alternative is used in the 5 most similar protocols

L. reuteri specific 16S rRNA primers, LR- f: ACCGAGAACACCGCGTTATTT; LR-r: CATAACTTAACCTAAACAATCAAAGATTGTCT (T_m: 59°C, R²:0.994) were used to calculate total copy number in colon feces by qPCR [28 (link)]. L. reuteri specific16S rRNA regions were amplified using 5–50 ng fecal DNA as template, 25 pmol/μl specific primers and 1X power SYBR green master mix (Applied Biosystems, Foster City, USA) in 20 μl final reaction volume. All PCRs were performed in duplicates using the StepOne plus Real-time PCR system (Applied Biosystems, Foster City, USA). The PCR conditions were: 95 °C for 10 min, followed by 40 cycles at 95 °C for 30 s, annealing for 30 s at respective T_m temperature, and 72 °C for 45 s. Melting curve analysis was carried out at the end.
The standard curve for L. reuteri quantification was generated by serial dilution of pJet plasmid (Invitrogen, Waltham, MA USA) in which 16S rRNA target sequence from L. reuteri 6475 (ATCC) was cloned. Copy number for the standard curve was calculated by formula: Number of copies = [amount (ng)* A] / [length (bp) * 1×10⁹ * 650] where A was the Avogadro constant (6.02× 10²³). The total bacterial 16S rRNA gene copy number /mg of sample was calculated using equation: Copy number / mg = [Mean Copy number × Volume of extracted DNA taken (μl)] / [Total volume of extracted DNA (μl) × mg of sample used for DNA isolation).

Hegde S., Lin Y.M., Fu Y., Savidge T, & Shi X.Z. (2020). Precision Lactobacillus reuteri therapy attenuates luminal distention-associated visceral hypersensitivity by inducing peripheral opioid receptors in the colon. Pain, 161(12), 2737-2749.

+ Open protocol

+ Expand

Allergen Protein Expression and Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA inserts of Der p 5 and Blo t 5 were generated by PCR, using an upstream oligonucleotide primer containing an SnaBI restriction site and a downstream oligonucleotide primer containing an Avr II restriction site. The DNA insert was ligated into a pJET plasmid (Invitrogen) and transformed into DH5α competent cells. PCR screening was performed, and the sequence of the insert was confirmed by DNA sequencing (GIGA, Belgium). The complementary DNA of Der p 5 and B lo t 5 was subcloned into a pPIC9K expression vector and transformed into E. coli DH5α cells.
The multiple sequence alignment of group 5 allergens was used to identify residues for site-directed mutagenesis. Mutant constructs were obtained by PCR-overlapping extension using designed oligonucleotide primers (1st BASE) with mismatches. Multiple mutants were generated using the mutated plasmids as a template.

Lahiani S., Dumez M.E., Khemili S., Bitam I., Gilis D, & Galleni M. (2019). Cross-Reactivity between Major IgE Epitopes of Family 5 Allergens from Dermatophagoides pteronyssinus and Blomia tropicalis. International archives of allergy and immunology, 178(1).

+ Open protocol

+ Expand

CRISPR/Cas9 Target Mapping by DNA/RNA Sequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To map the edits induced by CRISPR/Cas9 action, genomic DNA and mRNA (cDNA) were sequenced following amplification of the regions flanking the gRNA2 and gRNA8 targets. For gDNA sequencing, DNA was first isolated using Sigma mammalian genomic DNA miniprep kit (Sigma-Aldrich). The gDNA region flanking exon 2 was sequenced using MiSeq primers (Fw: tcgtcggcagcgtcagatgtgtataagagacagcaggttcatgcatgggagatctc; Rev: gtctcgtgggctcggagatgtgtataagagacagcctcacatggcctagcaatacg), performed as described previously (60 (link)). The TNPO3 genomic region corresponding to exon 8 was first PCR-amplified and the PCR fragments were cloned in the pJET plasmid (Thermo Scientific) and sequenced with the following primers: Fw, cgactcactatagggagagcggc and Rev, aagaacatcgattttccatggcag. For cDNA sequencing, RNA was extracted using the Aurum total RNA minikit (Bio-Rad) and cDNA was generated using the high-capacity cDNA reverse transcription kit (Thermo Scientific). Next, specific amplicons were generated by PCR: exon 2 (Fw: gcaggatgtggagtcatgc; Rev: ttccaggaaggcatctgtagg) and exon 8 (Fw: gcttatctgtgcaggccatcct; Rev: ctgataccctcatgcgaaactcc).

Janssens J., Blokken J., Lampi Y., De Wit F., Zurnic Bonisch I., Nombela I., Van de Velde P., Van Remoortel B., Gijsbers R., Christ F, & Debyser Z. (2021). CRISPR/Cas9-Induced Mutagenesis Corroborates the Role of Transportin-SR2 in HIV-1 Nuclear Import. Microbiology Spectrum, 9(2), e01336-21.

+ Open protocol

+ Expand

Genomic Analysis of P. gingivalis FimA and FimB

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was isolated from P. gingivalis clinical strains using Genomic Mini kit (A&A Biotechnology). The fimA and fimB genes were amplified using Phusion™ High-Fidelity DNA Polymerase (Thermo Fischer) with primers: fimA uni-F (AAGTTTTTCTTGTTGGGACTTGC), fimA uni-R (AACCCCGCTCCCTGTATTCCGA) (28 (link)) and fimB F (ATCGTATCGGTGCTGATCTTACTCG), fimB R (TCTGCATATTGTTGCACTACGTCCC). The amplification cycles were as follows: 98°C 30s initial denaturation, then 35 cycles of denaturation, annealing and extension 98°C 10s, 68°C 30s and 72°C 30s, respectively, and final extension 72°C, 10 min, 4°C hold. PCR products were run in 1% agarose gels containing ethidium bromide and bands corresponding to the fimA or fimB gene size were extracted from the gel using GeneJET Gel Extraction Kit (Thermo Fischer). The fimA or fimB gene was then cloned into the pJET plasmid (Thermo Fischer). Recombined plasmids were propagated in E. coli DH5α strain and isolated using GeneJET Plasmid Miniprep Kit (Thermo Fischer). All kits were used according to manufacturer’s instructions. Isolated plasmids were sequenced by Genomed, Poland and results were analyzed using Needle (EMBOS-EBI) and Chromas Lite (Technelysium Pty Ltd) programs.

Wielento A., Bereta G.P., Łagosz-Ćwik K.B., Eick S., Lamont R.J., Grabiec A.M, & Potempa J. (2022). TLR2 Activation by Porphyromonas gingivalis Requires Both PPAD Activity and Fimbriae. Frontiers in Immunology, 13, 823685.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!