Uv chamber

From the total sample of 447 adolescents, 437 were screened for gastric H. pylori infection using the UBT that consists in the exhalation of carbon dioxide in samples before and after swallowing urea labeled with non-radioactive carbon-13. The samples were then analyzed and each result would be classified as positive or negative for H. pylori infection.
To detect H. pylori on oral cavity, saliva was collected by the passive drool method into a polypropylene tube until reaching 2 milliliters of saliva in each tube per adolescent. Next, DNA was extracted using the MagNA Pure LC DNA Isolation Kit (Bacteria, Fungi) (Roche), quantified with Nanodrop (Thermo Lifesciences), and bacterial DNA was amplified using the Multiplex PCR kit (Qiagen) with primers that recognize all H.pylori strains: VacA_Fw: ATGGAAATACAACAAACACAC and VacA_Rv: CTGCTTGAATGCGCCAAAC(21). PCR products were observed, after electrophoresis in a 2% agarose gel stained with RedSafe (Intron), in a UV chamber (Bio-Rad). DNA bands with the expected molecular weight were excised from the agarose gel, purified with ULTRAPrep Agarose Gel Extraction kits (AHN), and sequenced with BigDye Terminator Sequencing Kit (Applied Biosystems). The obtained DNA sequences were compared with a control (H. pylori positive DNA sample diluted in saliva at different concentrations) and with NCBI database (http://www.ncbi.nlm.nih.gov/).

The ability of the analyzed fungus to grow on a minimal solid medium containing sterile PLA and PET fragments was tested in accordance with the PN-EN ISO 846 standard. The polymer materials were sterilized by rinsing in 70% ethyl alcohol and then UV irradiation for 5 min in a UV Chamber (Bio-Rad, Munich, Germany). A spore suspension of T. viride strain GZ1 with a density of 10⁶ spores/mL was prepared according to the procedure described by Znajewska et al. [16 (link)]. The experiment in the liquid minimal medium was carried out in 200 mL flasks containing 5 pieces of PLA or PET film (30 mm × 30 mm) inoculated with 50 µL of spore suspension. As a control, pieces PLA and PET film were incubated in the liquid minimal medium. Flasks were incubated for 3 months in the dark at 23 °C. The experiments were performed in triplicate. The obtained pieces of PLA and PET polymers after 3-month incubation were used for all experiments (SEM, DCS, FTIR, viscosity measurements, Western blot, and AFM).