The promoter regions were synthesized by PCR from a mouse embryonic genomic library. The genomic sequence of PDE5 was retrieved from GenBank. Based on this sequence, oligonucleotide couples were designed to amplify a 1,3 kb region upstream of the first ATG of Pde5a1 and Pde5a2. The PCR products were cloned into a PCR-TOPO vector (Thermo Fisher Scientific, Waltham, MA, USA), sequenced and, subsequently, subcloned into a luciferase reporter plasmid, pGL3basic (Promega, Madison, WI, USA) for luciferase assay. The different short luciferase constructs were generated by PCR or restriction enzyme digestions starting the long construct. Oligonucleotide primers are listed in Table 1 . Expression vectors coding for MyoD and Runx1 were purchased from Addgene (Watertown, MA, USA).
Pcr topo vector
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PCR-TOPO vector is a plasmid used for the direct cloning of PCR products. It features a linearized vector with single 3' thymidine (T) overhangs, which facilitate the ligation of PCR amplified DNA fragments with matching 3' adenine (A) overhangs.
Automatically generated - may contain errors
Lab products found in correlation
Qubit fluorometer, by Thermo Fisher Scientific (2 mentions)
Pgl3 basic, by Promega (1 mentions)
Platinum superfi 2 dna polymerase, by Thermo Fisher Scientific (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Hindiii, by New England Biolabs (1 mentions)
Xbai, by New England Biolabs (1 mentions)
Spectrum plant total rna kit, by Merck Group (1 mentions)
Dnase 1, by Promega (1 mentions)
Generacer kit, by Thermo Fisher Scientific (1 mentions)
All in one rt mastermix, by Applied Biological Materials (1 mentions)
Takara la taq, by Takara Bio (1 mentions)
Accuprime pfx dna polymerase, by Thermo Fisher Scientific (1 mentions)
E coli top10 cells, by Thermo Fisher Scientific (1 mentions)
Hek293 freestyle cells, by Thermo Fisher Scientific (1 mentions)
Pcdna3.1 topo, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
L dna analyzer, by Thermo Fisher Scientific (1 mentions)
C1000 touch thermocycler, by Bio-Rad (1 mentions)
Taq dna polymerase, by Thermo Fisher Scientific (1 mentions)
14 protocols using pcr topo vector
1
Cloning and Characterization of Pde5a Promoters
2
Generation of Regnase-1 Ser435/439Ala Knockin Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA containing the Regnase-1 gene was isolated from ES cells (GSI-1). An ∼12-kbp genomic fragment encompassing exon 5 and exon 6 and downstream of the Regnase-1 gene termination was subcloned into a pCR-TOPO vector (Thermo Fisher Scientific). A targeting vector was designed to replace Ser435 and Ser439 residues at exon 6 with Ala by site-directed mutagenesis. A neomycin-resistant gene flanked by two loxP sites was inserted into the intron between exons 5 and 6. The linearized vector was introduced into GSI-1 ES cells by electroporation. The targeted ES cells were screened and identified by genomic PCR and Southern blotting. These cells were microinjected into blastocysts from C57BL/6 mice. Chimeric male mice were bred with C57BL/6 female mice to produce F1 heterozygous mice. F1 mice were further bred with CAG-Cre transgenic mice to remove the neomycin gene cassette. After removal of the CAG-Cre allele by breeding with C57BL/6 mice, Regnase-1 AA heterozygous (Regnase-1AA/+) mice were backcrossed with C57BL/6 mice for at least ten generations, then intercrossed to obtain Regnase-1AA/AA homozygotes. All mouse experiments were approved by the Animal Research Committee of the Research Institute for Microbial Diseases, Osaka University.
3
Construction of Infectious HIV-1 Clone from Isolated Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HIV-1 subtype A/E was isolated from the plasma of a treatment-naive HIV-1+ individual collected at the NHTD as previously described (39 (link)). To construct a full-length infectious molecular HIV-1 clone from the isolated virus, a single HIV-1 clone was established using the SupT1 cell line by limiting dilution of the virus. DNA from the infected cells was then extracted and the entire genome was amplified in two fragments using Platinum SuperFi II DNA polymerase (Thermo Fisher Scientific, Vilnius, Lithuania). The 5′ fragment extended from the 5′ long terminal repeat (LTR) to the vif region, and the 3′ fragment extended from the vif region to the 3′ LTR. The 5′ fragment was amplified using the forward primer 5′-TGGATGGGCTAGTTTACTCCAAGAAAAGGAAAGAG -3′ and reverse primer 5′-GTCGGTGCTTCCGCTTCTTTCTGCCATAGG -3′, and the 3′ fragment was amplified using the forward primer 5′-CAGGGACAGCAGAGACCCAATTTGGAAAGG -3′ and reverse primer 5′-TGCTAGAGATTTTTACTCAGTCTAGAGTGGTCTGAGGG -3′. The amplified products were then cloned into a pCR-TOPO vector (Thermo Fisher Scientific) and sequenced using an ABI Prism 3130 automated sequencer (Thermo Fisher Scientific). The 5′ HIV-1 fragment was excised by restriction enzyme NotI and shared PflMI sites in the vif region and inserted into the 3′ HIV-1 fragment, thus generating the full-length infectious molecular clone VI-157X4.
4
Cloning and Quantifying WP_069098309.1 Fragment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The WP_069098309.1 fragment (280 bp) was synthesised by GeneScript and cloned into pCR-TOPO vector (ThermoFisher Scientific, New Zealand). The plasmid containing the WP_069098309.1 fragment was transformed into E. coli DH5-α cells by heat-shock and positive clones were selected using kanamycin. The standard DNA with WP_069098309.1 target sequence was extracted using PureYield Plasmid Midiprep purification kit (Promega, WI, USA) and quantified using Qubit fluorometer according to the manufacturer’s instructions (ThermoFisher Scientific, New Zealand). The DNA copy number was calculated based on the equation: DNA copy number = (M × 6.02 × 1023 × 10−9)/(n × 660)28, M: molecular weight, n: plasmid concentration measured at 260 nm. The DNA standards were prepared as 107, 106, 105, 104, 103, 500, 250, 100, 10 copies/μL and stored in aliquots at −20°C until used.
5
Cloning and Sequencing of CRF01_AE Env
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNAs of viral RNA from CRF01_AE-infected individuals were prepared as previously described [36] (link). The env region was first amplified using the following primers: 5′-GGTAGAGCAGATGCAGGATG-3′ and 5′-GTGGGTGCTATTCCTAGTGGTTC-3′ . Nested PCR was performed using primers carrying AflII and NheI restriction enzyme sites: 5′-GCACCTTAAG AAATCTGTAGAAATCAATTG-3′ and 5′-GCTAGC TACCTGTTTTAAAGCTTTATACC-3′ (underlines denote AflII and NheI sites, respectively). The amplified product was then cloned into a pCR-TOPO vector (Invitrogen) and sequenced using an ABI PRISM 3771 automated sequencer (Applied Biosystems). For construction of the Env expression vector carrying the V3 loop from CRF01_AE, the AflII-NheI fragment of cloned V3 regions was introduced into the AflII-NheI cloning site of pCXN-JR-FLan [19] (link), [20] (link), [21] (link). To construct the infectious molecular clone, the AflII-NheI fragment was similarly introduced into pJR-FLan [19] (link), [20] (link), [21] (link) as described previously, resulting in pJR-FLan carrying the V3 loop from CRF01_AE.
6
DAPIT Cloning and Expression in HEK293T
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full-length DAPIT cDNA was originally cloned in pCR-TOPO vector (Invitrogen, Carlsbad, CA, USA) [1 (link) ]. The DAPIT coding sequence–including ten nucleotides from the 5’ NCR–was recloned by PCR with the pEGFP sequence of the pIRES2-EGFP vectors (Clontech Laboratories, Palo Alto, CA, USA). The primers used were 5’- acgaattcgattgaagtcatggctggccca –3’ and 5’- tcgggatccttatgttgctttcacagctggggt –3’. The PCR reactions consisted of cycles at 96°C for 2 min, 4x (96°C for 30 s, 50°C for 1 min, 72°C for 30 s), 25x (96°C for 30 s, 60°C for 1 min, 72°C for 30 s) and 72°C for 10 min. The DAPIT amplicon was purified, cloned into the pIRES2-EGFP vector with EcoRI and BamHI restriction enzymes (MBI Fermentas GmbH, Leon-Rot, Germany; ClontechLaboratories, Palo Alto, CA, USA) and amplified in One Shot TOP 10 bacteria (Invitrogen). The insert size (~204 bp) was confirmed by restriction enzyme digestion, and the insert DNA was fully sequenced. The construct was used for stable transfection of HEK293T cells.
7
Monoclonal Antibody Variable Domain Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the monoclonal antibody‐expressing hybridoma cells using Qiagen RNeasy Plus Mini Kit (Qiagen, Germantown, MD) following manufacturer's instructions. The extracted total RNA was used as template for 5′‐RACE‐ready cDNA synthesis (Takara Bio, Mountain View, CA). The heavy chain variable domain (VH) and the light chain variable domain (VK) of 4D9 were amplified separately by PCR using the 5′‐RACE adaptor‐specific forward primer, rat IgG, or kappa constant‐specific reverse primers (Bradbury, 2010 ). For VK domain amplification, a peptide nucleic acid oligo (CCTGTGGAGGAGGAGGATGCT‐KK) was used to selectively amplify the functional kappa chain (Cochet et al, 1999 ). The PCR products of VH and VK were purified and cloned into the pCR‐TOPO vector (Invitrogen, Carlsbad, CA). The cloned vector was transformed into TOP10 E. coli (Invitrogen, Carlsbad, CA) by chemical transformation and selected on a LB agar plate containing 100 μg/ml carbenicillin. Sanger sequencing was done on bacteria colonies using the M13 forward and M13 reverse primers to sequence VH and VK of the 4D9 antibody.
8
Cloning and Characterization of gabT Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gabT gene was cloned from the genome of E. coli K12 via polymerase chain reaction (PCR) using the primers gabTF (5′-aagcttaatgaacagcaataaagagtt-3′) and gabTR (5′-tctagactactgcttcgcctcatcaaaac-3′). The 1294-bp amplified fragment was inserted into the pCRTOPO vector (Invitrogen, Carlsbad, CA, USA) to generate pCRgabT. We checked the sequence using an ABI Sequence Analyzer (Applied Biosystems, MA, USA), and the sequence was found to be identical to accession number 6061113 in the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov ) database. The gabT fragment was subcloned into the multiple cloning site of the broad-host-range plasmid pBBR1MCS-538 (link) using HindIII and XbaI (New England Biolabs, Hirchin, UK) to generate a lacZ::gabT translational fusion (pBBRgabT) (Fig. 2B ).
9
Plant Transcriptional Profiling by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sample collection, RNA isolation, and qRT-PCR were performed using established protocols66 (link). Unless otherwise specified, tissues were harvested at 20:00 h. Briefly, total RNA was isolated using a SpectrumTM Plant Total RNA Kit (Sigma, St. Louis, MO, USA) and treated with DNase I (Promega, Madison, WI, USA) to eliminate genomic DNA. One microgram of total RNA was reverse transcribed to cDNA using a 5X All-In-One RT MasterMix (Applied Biological Materials, Richmond, BC, Canada). Relative quantification of AtAAS, AtCM2, AtADT6, PhCM1, PhCM2, PhADT1, PhADT2, PhADT3, DAHPS, EPSPS, and ODO1 transcript levels were performed by qRT-PCR analysis with gene-specific primers (Supplementary Table 1 ) relative to the reference genes UBQ10 for petunia and Ubc for Arabidopsis10 (link),16 (link),36 (link). Changes in PhADT3S, PhADT3L, and PhCM2 transcript levels during a normal light/day cycle were analyzed by qRT-PCR using elongation factor 1-α (EF1-α) as a reference gene67 (link). Each data point represents an average of three independent biological replicates, unless indicated. AtCM2 transcript levels in wild type, cm2-1, and cm2-2 were analyzed by RT-PCR36 (link).
The 5′-RLM-RACE was performed using the GeneRacerTM Kit (Invitrogen) according to the manufacturer’s instructions. Obtained PCR fragments were subcloned into pCR-TOPO vector (Invitrogen) and sequenced.
The 5′-RLM-RACE was performed using the GeneRacerTM Kit (Invitrogen) according to the manufacturer’s instructions. Obtained PCR fragments were subcloned into pCR-TOPO vector (Invitrogen) and sequenced.
10
Cloning of HUVEC cDNA Library Fragments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA fragments from the HUVEC cDNA libraries were amplified by PCR using Takara LA Taq (Takara Bio, Shiga, Japan) with primers corresponding to the 5′ and 3′ ends of the multiple cloning site of pMX (5′-GGTGGACCATCCTCTAGACTG, 3′-CCTTTTTCTGGAGACTAAAT) and pRetro-Lib (5′-AGCCCTCACTCCTTCTCTAG, 3′- ACCTACAGGTGGGGTCTTTCATTCCC) vectors. The PCR products were cloned into pCR-TOPO vector (Invitrogen, San Diego, CA, USA)
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!