ChIP assays were performed essentially as described previously [26 (link)–28 (link)]. Chromatin was cross-linked with 1% formaldehyde. Aliquots of lysates containing 200 μg of protein were used for each immunoprecipitation reaction with anti-HDAC4 (Abcam), anti-acetyl histone H3, and anti-acetyl histone H4 (Millipore), or pre-immune IgG. Precipitated genomic DNA was amplified by real-time PCR with the primers spanning the rat miR-206 proximal promoter region: Forward, TGCCAGTGTCCGTTCCTCTC, and Reverse, CTTAGAGCTTGCCAAGGAGCTTC.
Anti hdac4
Manufactured by Abcam
Sourced in United Kingdom
Anti-HDAC4 is a primary antibody that recognizes the HDAC4 protein. HDAC4 is a histone deacetylase enzyme involved in the regulation of gene expression.
Automatically generated - may contain errors
Lab products found in correlation
Pierce bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Anti acetyl histone h3, by Merck Group (1 mentions)
Anti acetyl histone h4, by Merck Group (1 mentions)
Anti collagen type 1, by Rockland Immunochemicals (1 mentions)
Anti mrtf a, by Santa Cruz Biotechnology (1 mentions)
Magna lyser instrument, by Roche (1 mentions)
Anti β actin, by Merck Group (1 mentions)
Anti α sma, by Merck Group (1 mentions)
Tbs t buffer, by Thermo Fisher Scientific (1 mentions)
Ripa lysis buffer, by Cell Signaling Technology (1 mentions)
Pvdf membrane, by Merck Group (1 mentions)
Ecl system, by Merck Group (1 mentions)
Anti gapdh, by Abcam (1 mentions)
Anti pcna, by Abcam (1 mentions)
Ab2743, by Abcam (1 mentions)
Anti dnmt3a, by Abcam (1 mentions)
Anti dnmt3b, by Abcam (1 mentions)
Anti cbp, by Santa Cruz Biotechnology (1 mentions)
Anti dnmt1, by Abcam (1 mentions)
Anti dimethyl histone h3 lys9, by Abcam (1 mentions)
4 protocols using anti hdac4
1
ChIP Assays for Histone Modifications
2
Quantitative Protein Analysis in Liver
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Liver tissues were homogenized using the MagNA Lyser instrument (Roche) and re-suspended in RIPA buffer as previously described [25 (link)]. The proteins were quantified with the BCA reagent (Pierce) according to the manufacturer's protocol, and separated by 10% polyacrylamide gel electrophoresis. Western blot analyses were performed with anti-MRTF-A (Santa Cruz), anti-HDAC4 (Abcam), anti-collagen type I (Rockland), anti-α-SMA, and anti-β-actin (Sigma).
3
Western Blot for PCNA and HDAC4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cell lysate was prepared in RIPA lysis buffer (Cell Signaling Technology, USA) and concentrations of proteins were measured using the Pierce BCA Protein Assay kit (Thermo Scientific, Belgium) according to the manufacturer’s instructions. Then, the protein was applied to SDS-PAGE and PVDF membrane (Millipore, USA), then blocked with 5% milk in TBST buffer (Thermo Scientific, USA). Next, we incubated the primary antibodies: anti-PCNA (1: 1000, Abcam UK) and anti-HDAC4 (1: 1000, Abcam UK) or anti-GAPDH (1: 2000, Abcam UK) overnight at 4°C. Then, secondary antibodies (1: 5,000, Abcam UK) were subsequently add to the membranes. Finally, chemiluminescent detection was performed using the ECL system (Millipore, MA, USA).
4
Oligonucleotide and Antibody Preparation
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!