Total RNA was isolated using an RNA Pure High-purity Total RNA Rapid Extraction kit (BioTeke Corporation, Beijing, China), according to the manufacturer's protocol. cDNA was synthesized using the iSCRIPT cDNA synthesis kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). SLC6A1 or CDX2 mRNA expression levels were examined by qPCR using the iQ5 Real-Time PCR Detection system (Bio-Rad Laboratories, Inc.) and All-in-One qPCR mix with SYBR-Green (GeneCopoeia, Inc., Rockville, MD, USA). β-actin values were used for normalization. Primers used for PCR were purchased from GeneCopoeia, Inc. [cat. nos., HQP017395 (SLC6A1), HQP016381 (β-actin) and HQP000553 (CDX2); Rockville, MD, USA]. Amplification was performed with an initial 10-min denaturation step at 95°C, followed by 40 amplification cycles of 10 sec at 95°C, 20 sec at 60°C and 10 sec at 72°C. For detecting miR133a, reverse transcription was performed following the applied GeneCopoeia protocol and normalization was performed against U6. Primers were purchased from GeneCopoeia (HmiRQP3057 and HmiRQP9001). The 2−ΔΔCq method was employed for quantification (20 (link)).
Rnapure high purity total rna rapid extraction kit
Manufactured by BioTeke
Sourced in China
The RNApure High-purity Total RNA Rapid Extraction Kit is a laboratory equipment product designed for the rapid and efficient extraction of high-quality total RNA from a variety of biological samples.
Automatically generated - may contain errors
Lab products found in correlation
Taq hs perfect mix, by Takara Bio (2 mentions)
Sybr green, by BioTeke (2 mentions)
M mlv reverse transcriptase, by Takara Bio (2 mentions)
Transstart tip green qpcr supermix, by Transgene (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Iq5 real time pcr detection system, by Bio-Rad (1 mentions)
Hmirqp9001, by GeneCopoeia (1 mentions)
Reverse transcription system, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by BioTeke (1 mentions)
Exicycler 96 pcr system, by Bioneer (1 mentions)
Sybr green 1, by BioTeke (1 mentions)
Random primers, by GenScript (1 mentions)
Revertra ace qpcr rt master mix, by Toyobo (1 mentions)
Gdna remover, by Toyobo (1 mentions)
Tiangel purification kit, by Tiangen Biotech (1 mentions)
Sybr premix ex taq kit, by Takara Bio (1 mentions)
Nanodrop one, by Thermo Fisher Scientific (1 mentions)
Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Qpcr kits, by Bio-Rad (1 mentions)
Agilent mx3000p real time pcr system, by Agilent Technologies (1 mentions)
14 protocols using rnapure high purity total rna rapid extraction kit
1
RNA Extraction and qPCR Analysis
2
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following miRNAs transfection for 48 h, total RNA was extracted from HEPM and HOEC using BioTeke RNApure High-purity Total RNA Rapid Extraction Kit (BioTeke, China) according to the manufacturer's protocols. Quantitative real-time PCR primers were designed and synthesized by TSINGKE (Beijing, China) (Supplementary Table 2 ). The total RNA was converted into cDNA by using the Reverse Transcription System (ThermoFisher, USA). The relative mRNA expression level and the internal control GAPDH were quantified on ABI PrismR 7900HT Real-Time PCR System (Applied Biosystems). All reactions were conducted in triplicate, and the data were analyzed by the 2–ΔΔCt method (Hu et al., 2016 (link)).
3
Rapid RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An RNA pure High-purity Total RNA Rapid Extraction Kit (BioTeke, Beijing, China) was used
to isolate total RNA from kidney tissue according to the manufacturer’s instructions.
Complementary DNA was reverse transcribed using the purified RNA and M-MLV reverse
transcriptase (BioTeke). PCR was performed using 1 µl template cDNA, 10
µl SYBR GREEN master mix (2X), and 0.5 µl forward and
reverse primers (10 µM per primer concentration) in a 20
µl system. The optimal reaction condition was set as follows: 10 min at
95°C and then 40 cycles of 10 s at 95°C, 20 s at 60°C, and 30 s at 72°C. Quantitative
analysis was performed using an Exicycler™ 96 quantitative fluorescence instrument
(Bioneer, Daejeon, Korea). Relative gene expression was normalized to β-actin and
calculated using the 2−ΔΔCt method.
to isolate total RNA from kidney tissue according to the manufacturer’s instructions.
Complementary DNA was reverse transcribed using the purified RNA and M-MLV reverse
transcriptase (BioTeke). PCR was performed using 1 µl template cDNA, 10
µl SYBR GREEN master mix (2X), and 0.5 µl forward and
reverse primers (10 µM per primer concentration) in a 20
µl system. The optimal reaction condition was set as follows: 10 min at
95°C and then 40 cycles of 10 s at 95°C, 20 s at 60°C, and 30 s at 72°C. Quantitative
analysis was performed using an Exicycler™ 96 quantitative fluorescence instrument
(Bioneer, Daejeon, Korea). Relative gene expression was normalized to β-actin and
calculated using the 2−ΔΔCt method.
4
Quantifying Gene Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from bone tissues or transfected EA.hy926 cells using an RNApure high-purity total RNA rapid extraction kit (BioTeke, China) following the manufacturer’s protocol. Afterward, total RNA was reverse-transcribed into cDNA using M-MLV reverse transcriptase and RNase inhibitor (Takara, Japan). qRT-PCR was conducted using Taq HS Perfect Mix (Takara, Japan) and SYBR Green (BioTeke, China) in an Exicycler 96 PCR system (BIONEER, Korea). Relative quantification of gene expression was determined using the 2−ΔΔCt method. β-actin was employed as a housekeeping gene for internal normalization. Primer sequences (5′–3′) are as follows: Rat Sox11, forward-AGGATGCCGACGACCTCATG, reverse-GAAGTTCGCCTCCAGCCAGT; Human SOX11, forward-ACGGTCAAGTGCGTGTTTCTG, reverse-TGCTGGTGCGGTGGTTCCTC; Human CD31 (gene name PECAM1), forward-AAGATAGCCTCAAAGTCG, reverse-CTGGGCATCATAAGAAAT.
5
Gene Expression Analysis of Aortic and VSMC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs in thoracic aortas or cultured VSMCs were extracted using an RNApure high-purity total RNA rapid extraction kit (BioTeke Corporation, Beijing, China) according to the manufacturer’s instructions. The first-strand complementary DNAs were synthesized with oligo(dT)15 as primer using M-MLV reverse transcriptase (Takara Biomedical Technology, Beijing, China). Real-time quantitative polymerase chain reaction (qPCR) was performed using SYBR Green I (BioTeke) in Bioneer Exicycler 96 instrument. The sequences for primers were: Homo HOXA1, 5’-CGCTCCCGCTGTTTACTC-3’ and 5’-AGGCTCTGGTGCTCCTGTCC-3’; Homo NF-κB RelA (p65), 5’-GGGGACTACGACCTGAATG-3’ and 5’-GGGCACGATTGTCAAAGAT-3’; Homo KLF4, 5’-CGAACCCACACAGGTGAGAA-3’ and 5’-TACGGTAGTGCCTGGTCAGTTC-3’; Homo MAC2, 5’-ATGATGCGTTATCTGGGTCT-3’ and 5’-GGTGGCACTTGGCTGTC-3’; Homo MAC3, 5’-CCAGAAGCTGGAACCTA-3’ and 5’-CTGCCTGTGGAGTGAGT-3’; Homo ABCA1, 5’-TCACCACTTCGGTCTCC-3’ and 5’-CCACCTTCATCCCATCT-3’; Homo ACTA2 (α-SMA), 5’-GGGGTGATGGTGGGAATG-3’ and 5’-GCAGGGTGGGATGCTCTT-3’; Homo MYH11, 5’-CAGGATAGGGCAGAGCAA-3’ and 5’-GCCAAGTAGCCACGACAC-3’; Homo CNN1, 5’-CCACCCTCCTGGCTTTG-3’ and 5’-ATGATGTTCCGCCCTTCT-3’; Mus HOXA1, 5’-AAGCAGAAGAAGCGTGAGA-3’ and 5’-GTGGGAGGTAGTCAGAGTGTC-3’.
6
Quantitative Gene Expression Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression level of genes was analyzed using RT-qPCR. Total RNA was extracted from cells using the RNApure High-purity Total RNA Rapid Extraction Kit (BioTeke, China). Complementary DNA was synthesized from the total RNA samples by reverse-transcribing with reverse transcriptase M-MLV (Takara), oligo (dT)15 and random primers (Genscript, China). Next, RT-qPCR was carried out using SYBR Green (BioTeke) and Taq™ HS Perfect Mix (Takara). The sequence of primers used in RT-qPCR was presented in Table 1 . The mRNA expression level of β-actin was used as an endogenous control. The results were analyzed using the 2−ΔΔCt method.
The sequence of primers used in RT-qPCR
| | Primers | |
|---|---|---|
| Type | Sequence (5′-3′) | |
| FTO | Forward | GAACACCAGGCTCTTTACG |
| Reverse | ATGAACCCATCCCAACC | |
| STAT3 | Forward | TGGAGAAGGACATCAGCGGT |
| Reverse | TGGTCTTCAGGTATGGGGCA | |
| β-actin | Forward | CACTGTGCCCATCTACGAGG |
| Reverse | TAATGTCACGCACGATTTCC | |
7
Characterization of BpPP2C1 in Betula platyphylla
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from leaves of wild type Betula platyphylla according to manufacture protocol using RNA pure High-purity Total RNA Rapid Extraction Kit (BioTeke). cDNA synthesis was made using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo, China). Protein coding sequence (CDS) of BpPP2C was obtained from reference genome of Betula platyphylla1 . PCR primers P1 were designed for PCR cloning (All primer sequences used in this study were shown in Supplementary Table S1 ). PCR products were detected by 1% agarose gel electrophoresis and purified using TIAN gel Purification Kit (TIANGEN, Harbin, China) and sequenced (TSINGKE Biological Technology, Harbin, China). Physicochemical properties of amino acids of BpPP2C1 were analyzed using ExPASy2 . Protein secondary structure was predicted using PredictProtein3 . Based on annotation of birch genome, 34 PP2C family genes including BpPP2C1 were found. 80 PP2C family genes of Arabidopsis were found in TAIR4 . The above PP2C family gene sequences are compared by ClustalX and infer phylogenetic trees by MEGA5.2.
8
Extraction and qPCR Analysis of Total RNA from Healthy Nucleus Pulposus Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from healthy nucleus pulposus cells using the RNApure High-purity Total RNA Rapid Extraction kit (BioTeke) according to the manufacturer's protocol and the quality and integrity of RNAs were detected using a NanoDrop One instrument (Thermo Fisher Scientific, Inc.) and 1% agarose gel electrophoresis. Subsequently, total RNA was reverse transcribed into cDNA using a First-strand cDNA Synthesis kit (cat. no. NP100041; OriGene Technologies, Inc.) according to the manufacturer's protocol. qPCR was performed using the SYBR Premix Ex Taq kit (Takara Biotechnology Co., Ltd.) and an ABI 7500 Fast real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The sequences of the primers (Abcam) used for qPCR are presented in Table II .
The master mix used for qPCR consisted of 7.5 µl 2X SYBR Premix, 0.5 µl forward primer, 0.5 µl reserve primers, 2 µl template and 4.5 µl DEPC water. The following thermocycling conditions were used for qPCR: Initial denaturation at 95°C for 3 min; followed by 39 cycles at 95°C for 15 sec and 55°C for 30 sec, and extension at 72°C for 30 sec. mRNA expression levels were quantified using the 2−∆∆Cq method and normalized to the internal reference gene GAPDH (25 (link)).
The master mix used for qPCR consisted of 7.5 µl 2X SYBR Premix, 0.5 µl forward primer, 0.5 µl reserve primers, 2 µl template and 4.5 µl DEPC water. The following thermocycling conditions were used for qPCR: Initial denaturation at 95°C for 3 min; followed by 39 cycles at 95°C for 15 sec and 55°C for 30 sec, and extension at 72°C for 30 sec. mRNA expression levels were quantified using the 2−∆∆Cq method and normalized to the internal reference gene GAPDH (25 (link)).
9
Rapid Extraction of Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNApure High-Purity Total RNA Rapid Extraction Kit (BioTeke, Beijing, China) according to the manufacturer’s instructions. After DNase digestion, total RNA was eluted with 30–80 μL RNase-free water and stored at −80°C. The purity and integrality of extracted total RNA were determined by the ratio of absorbance at 260 nm to that at 280 nm and via gel imaging.
10
Quantifying Cancer Cell mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cancer cells using the RNA pure High-purity Total RNA Rapid Extraction Kit (BioTeke, RP1201, China) following the manufacturer’s protocol. Real-time (RT) and quantitative polymerase chain reaction (qPCR) kits (Bio-Rad) were used to determine the mRNA expression levels. The RT and qPCR reactions were conducted as previously described [18 (link)]. Relative mRNA expression was calculated using the comparative cycle threshold (CT) (2−ΔΔCT) method. GAPDH was used as an endogenous control to normalize the data.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!