First strand cdna synthesis kit

qPCR analyses for the patients samples were performed on 150 ng total RNA isolated by RNeasy Micro Kit (Qiagen). For cell line analyses 500 ng total RNA was transcribed using First Strand cDNA Synthesis Kit (Fermentas St. Leon-Rot, Germany) together with 500 ng of universal human reference (UHR, Stratagene, Agilent technologies, Texas USA). Quantitative real-time PCR analyses were performed on Eppendorf Master Cycler using SYBR Green (Fermentas, St. Leon-Rot, Germany) as fluorescence detection method with the following primers; RPLPO-F: TGAGGTCCTCCTTGGTGAACA, RPLPO-R: CCCAGCTCTGGAGAAACTGC, IRX2-F: CCGAGAAACAAAAGCGAAGA, IRX2-R: AGCACGAGTGATCCGTGAG, CCL5-F: CTCGCTGTCATCCTCATTGC, CCL5-R: AAAGCAGCAGGGTGTGGTG, CXCL1-F: CTGAACAGTGACAAATCCAAC, CXCL1-R: CCTAAGCGATGCTCAAACAC, CXCL7-F: GAACTCCGCTGCATGTGTATAA, CXCL7-R: GCAATGGGTTCCTTTCCCGAT, CXCL8-F: GAATTCTCAGCCCTCTTCAAAAAC, CXCL8-R: GCCAAGGAGTGCTAAAGAACTTAG, CXCL10-F: GAAGGGTGAGAAGAGATGTC, CXCL10-R: TAGGGAAGTGATGGGAGAG, CXCL16-F: CCCGCCATCGGTTCAGTTC, CXCL16-R: CCCCGAGTAAGCATGTCCAC. The analyses were performed in triplicates and the mean values were used for each gene. The mRNA levels were normalized to the mRNA level of the ribosomal RPLP0 gene using ΔΔCT-method for quantification. The results, expressed as N-fold differences in target gene expression compared to universal human reference (UHR) or parental cell line expression.

Total RNA was extracted from tumors and adjacent non‐tumor tissues by the Trizol isolation reagent (Invitrogen, Thermo Fisher) according to the manufacturer's instructions. RNA integrity was examined by gel electrophoresis, and the absorption ratio at 260–280 nm (A260/280) was used for assessing the quantity of RNA. First Strand cDNA Synthesis Kit (Fermentas, Cat. No: K1622) was used for cDNA synthesis according to the manufacturer's instructions.

RNA was isolated using the NucleoSpin RNA II kit (Macherey-Nagel GmBH & Co., Dueren, Germany). cDNA synthesis was performed using the First Strand cDNA Synthesis kit (Fermentas, St. Leon-Rot, Germany). Real-time quantitative PCR was carried out with SYBR green master mixture (Promega, Madison, WI, USA) using Mx3005P Real-Time PCR system (Agilent, Santa Clara, CA, USA). Results were normalized to β-actin. Primers sequences are available upon request.

RNA was converted into cDNA using First-Strand cDNA Synthesis kit (Fermentas, Thermo Fisher Scientific, Waltham, USA). RT-qPCR reactions were run in triplicates on a Bio-Rad CFX96 Real Time PCR Detection System using Bio-Rad SsoAdvanced Universal Sybr Green Supermix. ACTB was used as a reference gene. The primers used were: AFF3 (5′-AGGCCAAGCTCTCCAAGTTC-3′, 5′-ACACAGCTGTTGGTTTCTCCA-3′), ISM1 (5′-CCACCGAAGTGAGTCTGCTT-3′, 5′-CTCGCTTTTGCAGCTCATCC-3′), ACTB (5′-TCATGAAGTGTGACGTGGACATC-3′, 5′-CAGGAGGAGCAATGATCTTGATCT-3′). After an initial denaturation step (95 °C for 30 s), 40 cycles of 95 °C for 5 s and 58 °C for 7 s (AFF3, ISM1) or 12 s (ACTB) were executed. Melting curve analysis was performed after amplification. The 2^−ΔΔCt method was used to calculate relative expression. The two-sample Wilcoxon rank sum test with continuity correction was used for statistical analysis.

The presence of CHIKV RNA in the infected cells was assessed by RT-PCR. Vero cells were infected with DRDE-06 virus and treated with 10, 50 and 100 µM of the drug for 14 h. Total cellular RNA was isolated using Trizol Reagent (Invitrogen, USA). RT was performed with 1 µg RNA by using the First Strand cDNA synthesis kit (Fermentas, USA) as per the manufacturer's instructions. In order to detect all viral cDNAs, each sample was subjected to PCR amplification using specific primers for CHIKV nsp1, nsp2, nsp3, nsp4 (manuscript under preparation), E1 and HSP90 [41] (link), [42] (link). The RT-PCR products were subjected to 1.5% agarose gel electrophoresis and GAPDH served as internal amplification control.