Reverse transcriptase

Total RNA from the cultured cells and tissues was extracted using RiboX reagent (Invitrogen) according to the manufacturer's instructions. Extracted RNA was analyzed for its purity and integrity by spectrophotometry and gel electrophoresis. RNA (2 μg) was converted into cDNA using Reverse Transcriptase (Takara). For miRNA detection polyA tail was added to the 3′ end of RNAs before cDNA synthesis. QRT-PCR was performed using BIOFACT™ 2X Real-Time PCR Master Mix in the Applied Biosystems StepOne Real-Time PCR. GADPH and U48 were used as internal controls. The relative expression level was calculated using the 2^−ΔΔCt and 2^−ΔCt methods. Primers and oligo sequences used in this study are listed in Supplementary Table 1.

Total RNA was extracted using the acid guanidium thiocyante/phenochloroform method, using a total RNA isolation reagent (Trizol Reagent, Invitrogen,USA) according to the manufacturer’s instructions. The RNAs were reverse-transcribed to cDNAs in a Thermal Cycler using Oligo (dT) primer (Invtirogen), RNase Inhibitor (Takara), Reverse transcriptase (Takara), dNTP Mixture and RNA PCR buffer (Sigma). A quantitative RT-PCR assay was carried out with a LightCycler™ (Roche Diagnostics, Mannheim, Germany) using the double-stranded DNA dye SYBR Green 1 (Roche Diagnostics) in order to observe the level of mRNAs. Primer sequence and size used in this study were shown in Table 2. Quantification was performed by comparing the levels obtained with standard samples as a previous study [21 (link)]. In the present study, the concentrations of cDNA in the unstimulated samples were 0.2, 0.5, 1.0 and 2.0 μl. Melting curve analyses were performed after the PCR amplification and to confirm no primer dimmer in the PCR products. The ratios of HSP70 mRNA expression were adjusted by the value of the housekeeping gene GAPDH.Table 2

Primer sequence and size used in this study

Gene	Sequence		Size
HSP70	Forward	5’-CGGACGAGTACAAGGTTGA-3’	206
	Reverse	5’- CTCTTTCTCCGCCAACTG-3’
GAPDH	Forward	5’-AGGGGCTCTCCAGAACATCA-3’	196
	Reverse	5’-GCCTGCTTCACCACCTTCTT-3’

Total RNA was extracted from leaf samples taken at 7, 14, 21, and 28 days after exposure to SYST2 VOCs using TRIzol reagent (Invitrogen Biotechnology Co., Carlsbad, CA, USA) according to the manufacturer’s instructions. First-strand cDNA was synthesized using reverse transcriptase (TaKaRa Bio Inc., Tokyo, Japan) and random hexamer primers. Real-time PCR was performed with SYBR Green/Fluorescent qPCR master mix (Takara) on a Roche-480 system (Roche) using the EF-1α gene (Berberich et al., 1995 ) as an internal reference.
The relative expression levels of Exp2, Exp9, Exp18. ACO-1. GA (20ox-1). SlIAA1, SlIAA3, and SlCKX1 were assayed. For qRT-PCR, the instrument was programmed for denaturation at 95°C for 1 min, followed by 40 cycles of amplification at 95°C for 5 s, 57°C for 30 s, and 72°C for 30 s. The specific primers for the target genes and the internal reference gene (EF-1α) are given in Supplementary Table S1. Each sample was replicated three times and the data was analyzed using the 2^-ΔΔCt method (Livak and Schmittgen, 2001 (link)).

Total RNA was extracted from mouse tissues or cells using Trizol reagent (Takara, Dalian, China) and cDNA synthesized using reverse transcriptase (Takara, Dalian, China). RT-PCR was performed with SYBR Green master mix (Takara) following the manufacturer’s instructions with the following primers targeting the corresponding mouse genes: MALAT1 forward 5′-CATGGCGGAATTGCTGGTA-3′ and reverse 5′- CGTGCCAACAGCATAGCAGTA-3′; METTL3 forward 5′-CAGTGCTACAGGATGACGGCTT-3′ and reverse 5′- CCGTCCTAATGATGCGCTGCAG-3′; Ly6c forward 5′-GCAGTGCTACGAGTGCTATGG-3′ and reverse 5′-ACTGACGGGTCTTTAGTTTCCTT-3′; IL-1β forward 5′-GTCGCTCAGGGTCACAAGAA-3′ and reverse 5′-GTG-CTGCCTAATGTCCCCTT-3′; iNOS forward 5′-CAGGGCCACCTCTACATTTG-3′ and reverse 5′- TGCCCCATAGGAAAAGACTG −3′; MCP-1 forward 5′-GTTAACGCCCCACTCACCTG-3′ and reverse 5′-GGGCCGGGGTATGTAACTCA-3′; F4/80 forward 5′-TGACTCACCTTGTGGTC-CTAA-3′ and reverse 5′-CTTCCCAGAATCCAGTCTTTCC-3′; IL-6 forward 5′-AGTTGCCTTCTTGGGACTGA-3′ and reverse 5′-TCCACGATTTCCCAGAGAAC-3′; TNF-α forward 5′-CATCTTCTCAAAATTCGAGTGACAA-3′ and reverse 5′-TGGGAGTAGACAAGGTACAACCC-3′; PTBP1 forward 5′-CACCGCTTCAAGAAACCAGGCT-3′ and reverse 5′-GTTGCTGGAGAAGAGGCTCTTG-3’; USP8 forward 5′- GCCTGCTACAAAGAGTGTTCCAC-3′ and reverse 5’ -GGAGAGGGAAATACTGGCTTGG-3′; and GAPDH (internal control mRNA) forward 5′-GGCATGGACTGTGGTCATGAG-3′ and reverse 5′-TGCACCACCAA-CTGCTTAGC-3′.

Total RNA was extracted from human cancer cells or nematodes. RNA was reverse transcribed using gene-specific primers and reverse transcriptase (Takara Bio, Inc., Kyoto, Japan), and the resulting cDNAs were amplified by PCR. The primers used for the assays are listed in Table S1. PCR products were resolved on a 1.5% agarose gel. The quantitation of the RT-PCR bands was performed using densitometry. β-Actin RNA levels were used to standardize the amounts of RNA in each sample.