qPCR was used to detect the expression of vasculogenesis-associated genes (Supplementary Table 3 ). Candidate primers and the reference beta-2 microglobulin (β2M) genes were designed using the Primer-Blast database (NCBI, USA). For qPCR reactions, synthesized cDNA (1 μl) was used in a 20 μl reaction containing PerfeCTa® SYBR Green FastMix (10 μl, Quanta Biosciences, USA) and sense and antisense primers (300 nм) using a MasterCycler Realplex4 (Eppendorf, Germany). Reaction conditions comprised an initial 2 min denaturation step at 95 °C, followed by 45 cycles of 95 °C denaturations for 10 s, a 30 s annealing step at the required temperature (Supplementary Table 3 ), and a 10 s elongation step at 72 °C. Transcripts abundances were normalized to the expression of β2M. Samples were run in triplicate in each assay. Normalized expression values were calculated following the mathematical model proposed by Pfaffl using the formula: 2−ΔΔCt 54 (link).
Mastercycler realplex4
Manufactured by Eppendorf
Sourced in Germany, United States, France, Italy
The MasterCycler RealPlex4 is a real-time PCR thermocycler produced by Eppendorf. It is designed to perform quantitative real-time polymerase chain reaction (qPCR) experiments. The device features four independently controlled thermal blocks, allowing for simultaneous processing of up to four samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (12 mentions)
Trizol, by Thermo Fisher Scientific (6 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (4 mentions)
Nanodrop, by Thermo Fisher Scientific (4 mentions)
Mmulv reverse transcriptase, by Biotechrabbit (3 mentions)
Qpcr green master mix, by Biotechrabbit (3 mentions)
Iq sybr green supermix, by Bio-Rad (3 mentions)
Realplex software, by Eppendorf (3 mentions)
First strand cdna synthesis kit, by Euromedex (3 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Nucleospin rna protein, by Macherey-Nagel (3 mentions)
Real mastermix sybr green detection system, by Eppendorf (3 mentions)
Ultrasybr mixture kit, by Thermo Fisher Scientific (2 mentions)
Hifiscript cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Revertaid h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Qpcr kit master mix, by Roche (2 mentions)
Iscript cdna synthesis kit, by Bio-Rad (2 mentions)
Qubit 3.0 fluorometer, by Thermo Fisher Scientific (2 mentions)
67 protocols using mastercycler realplex4
1
Quantitative PCR Analysis of Vasculogenesis Genes
2
Mosquito Gene Copy Number Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR reactions were performed using the QuantiNova SYBR Green PCR Kit (Qiagen) following the manufacturer’s instructions on an Eppendorf Mastercycler RealPlex4, on genomic DNA from four mosquitoes and using gene-specific primers, after having verified their efficiency (S4 Table ). DNA was extracted using DNA Isolation DNeasy Blood & Tissue Kit (Qiagen). Estimates of gene copy number were performed based on the 2-ΔCT method using Piwi6 and the para sodium channel genes (AALF000723) as references [57 (link)].
3
RNA Isolation and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples were extracted using TRIzol reagents (Thermo Fisher Scientific, Waltham, MA, USA), subjected to DNase treatment, and RNA cleanup using an RNA-mini kit (Qiagen, Hilden, Germany). Three replicates of total RNA samples were used. One microgram of total RNAs was used to construct cDNA using MMuLv reverse transcriptase (Biotechrabbit, Berlin, Germany) in a final volume of 20 μL. The cDNA was diluted five times. Quantitative-realtime PCR (qPCR) reaction was performed according to Butsayawarapat et al. [42 (link)] using QPCR Green Master Mix (Biotechrabbit, Berlin, Germany) on a MasterCycler RealPlex4 (Eppendorf, Hamburg, Germany). For each sample, the PCR reaction was performed in triplicate. Each reaction contained 1 μL of diluted cDNA, 0.5 μM of each primer and 10 μL of QPCR Green Master Mix in a final volume of 20 μL. The PCR cycle was 95 °C for 2 min, followed by 45 cycles of 95 °C for 15 s and 60 °C for 30 s. Amplification specificity was validated by melt-curve analysis at the end of each PCR experiment. Relative gene expression was calculated using the 2−∆∆CT method. Primers used to study Jatropha’s gene expression were previously reported by Juntawong et al. [29 (link)]. The genes and primers used in Arabidopsis are shown in Supplementary Materials Table S3 .
4
RT-qPCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissues using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA); the concentration of RNA was determined using a SpectraMax M5 microplate reader (Molecular Devices, LLC, Sunnyvale, CA, USA) and the purity of the samples was estimated from the optical density ratio (A260/A280, 1.8–2.2). RT was performed using an M-MLV Platinum RT-qPCR kit (Invitrogen; Thermo Fisher Scientific, Inc.) with the reaction parameters of incubation at 65°C for 5 min, 37°C for 52 min and 70°C for 15 min. qPCR was conducted with a total reaction volume of 20 µl using iQ™ SYBR®-Green Supermix (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and a MasterCycler Realplex4 (Eppendorf, Hamburg, Germany). A total of 3 parallel experiments of one sample were conducted. A total of 60 cycles of qPCR were performed. The thermocycling conditions were as follows: Denaturation at 95°C for 2 min; annealing at 95°C for 15 sec and extension at 60°C for 30 sec. Primers were obtained from Invitrogen (Thermo Fisher Scientific, Inc.); the sequences are presented in Table I . The relative expression of each gene normalized to β-actin was determined using the 2−ΔΔCq method (17 (link)). mRNA expression levels were calculated as percentages of the expression in the median tissue from the HFD group.
5
Exosomal miRNA Profiling and Validation
6
Quantitative Analysis of miRNA and mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells and tissues by using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). Complementary deoxyribonucleic acid was synthesized with a HiFiScript cDNA Synthesis Kit in accordance with manufacturer's instruction (Life Technologies, CA, USA). Then, the Complementary deoxyribonucleic acid was used for real‐time quantitative polymerase chain reaction assay carried out on an Eppendorf MasterCycler RealPlex4 (Eppendorf, Wesseling‐Berzdorf, Germany) using an Ultra SYBR Mixture kit (Thermo Fisher Scientific). The relative expressions of miRNA and messenger RNA (mRNA) were normalized by U6 and β‐actin, respectively, and calculated by the 2−ΔΔCT method. The primers used in the present study were listed as follows (5’–3’):
MiR‐363 (F): GCCGGGTGGATCACGATG
MiR‐363 (R): GTGCAGGGTCCGAGGT
NOTCH1 (F): GCACGTGTATTGACGACGTTG
NOTCH1 (R): GCAGACACAGGAGAAGCTCTC
FOXC2 (F): AACGAGTGCTTCGTCAAGGT
FOXC2 (R): TCTCCTTGGACACGTCCTTC
β‐actin (F): CCCTGGAGAAGAGCTACGAG
β‐actin (R): CGTACAGGTCTTTGCGGATG
U6 (F): CTCGCTTCGGCAGCACA
U6 (R): AACGCTTCACGAATTTGCGT
MiR‐363 (F): GCCGGGTGGATCACGATG
MiR‐363 (R): GTGCAGGGTCCGAGGT
NOTCH1 (F): GCACGTGTATTGACGACGTTG
NOTCH1 (R): GCAGACACAGGAGAAGCTCTC
FOXC2 (F): AACGAGTGCTTCGTCAAGGT
FOXC2 (R): TCTCCTTGGACACGTCCTTC
β‐actin (F): CCCTGGAGAAGAGCTACGAG
β‐actin (R): CGTACAGGTCTTTGCGGATG
U6 (F): CTCGCTTCGGCAGCACA
U6 (R): AACGCTTCACGAATTTGCGT
7
Quantification of NeoDGAT2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative NeoDGAT2 transcript abundance was quantified using quantitative real-time PCR (qPCR). Total RNA was extracted from cells cultured under N-starvation condition I at stationary phase using TRI Solution (GeneMark, Taiwan). The cDNA was prepared from the total RNA using oligo (dT)18 primer and RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific, Canada). The cDNA was amplified by KAPA SYBR FAST qPCR Kit (Kababiosystems, USA) using NeoDGAT2-gene specific primers: DGAT-RT-F1 (GGCGACAAAGGTCTTCCTCC) and DGAT-RT-R1 (GGCTCGTATCCGATTACAAAGG) and endogenous Actin (NeoActin)-gene specific primers: NeoActin-F1 (ACACTGTGCCCATCTATGAGGG) and NeoActin-R1 (CTTGATGTCACGCACGATTTCG). Mastercycler realplex4 and realplex software (Eppendorf, Germany) were used for the analysis. Fold difference of transcript was calculated using the ΔΔCt method. The NeoDGAT2 transcript level was normalized to NeoActin transcript used as a reference.
8
Total RNA Extraction and miRNA/mRNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated using the TRIzol reagent (Invitrogen, Dardilly, France) or miRNeasy kit (Qiagen, Courtaboeuf, France) following the manufacturer’s instruction. One microgram of total RNAs was reverse-transcribed by using the NCodeTM miRNA first-strand cDNA synthesis kit (Invitrogen) to quantify mature microRNA (miRNA) levels, or using the first-strand cDNA synthesis kit (Euromedex) to quantify mRNA expression levels. Quantitative RT-PCR (qRT-PCR) (quantitative Reverse-Transcription Polymerase Chain Reaction) was performed on a Mastercycler Realplex4 (Eppendorf, Montesson, France) using SYBR Green qPCR Master Mix (Roche) and specific primers (Table S1 ). qRT-PCR analysis of miR-18 and U6 were performed using forward primers (Table S1 ) and a universal reverse primer provided by the NCodeTM miRNA first-strand cDNA synthesis kit. Human β-actin and mouse 36B4 were used as internal controls for quantification of mRNA. U6 was used as an internal control for quantification of miR-18 expression. The fold-induction was calculated by using the Ct method as follows: ΔΔCt = (Cttarget gene − Ctinternal control)treatment − (Cttarget gene − Ctinternal control)nontreatment, and the final data were derived from 2−ΔΔCt.
9
Influenza A PR8 Strain RT-PCR and CRISPR Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RT-PCR amplified template was the RNA of the influenza A PR8 strain. The primers were listed in Table 2
10
Quantitative mRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extractions of RNA and mRNA detection were carried out as previously described [13 (link)]. The total RNA of cells was extracted using Trizol reagent (Life Technologies, Grand Island, NY). cDNA was synthesized from 5 μg of total RNA. The reverse transcribed cDNA (5 μL) was amplified to a final volume of 50 μL by PCR under standard conditions. Real-time PCR experiments were performed on a MasterCycler RealPlex4 (Eppendorf North America) system using the qPCR Kit master mix (Kapa Biosystems, Boston, USA). The reaction condition was the following: 95°C for 2 min, then 95°C 15 sec, 60°C 20 sec, 72°C 20 sec for 40 cycles in 20 μl per reaction volume. Primer sequences for HDAC4 used in these studies are the following: Forward: 5-CTG CAA GTG GCC CCT ACA G-3, Reverse: 5-CTG CTC ATG TTG ACG CTG GA-3. GAPDH was used as the internal control: Forward: 5-ACC ACA GTC CAT GCC ATC AC-3; Reverse: 5-TCC ACC ACC CTG TTG CTG TA-3.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!