Improm 2 reverse transcription kit

Using Trizol reagent protocol (Sigma), total RNA was isolated from naïve MSCs according to the manufacturer's instructions. The quality and quantity of RNA were quantified using a Nanodrop (Thermo-Scientific, Rockford, IL). First-strand cDNA synthesis was performed following the manufacturer's instructions (Improm II reverse transcription kit; Promega, Madison, WI) using oligo dT primers. Real-time qPCR was performed in triplicate using SYBR Green Master Mix and a Real-time PCR system (CFX96; BioRad Laboratories, Hercules, CA). The following primers were used: 

AT2R-F: 5′-GTTCCCCTTGTTTGGTGTAT-3′.

 

AT2R-R: 5′-CATCTTCAGGACTTGGTCAC-3′.

 

GAPDH-F: 5′-CCCATCACCATCTTCCAGGAG-3′.

 

GAPDH-R: 5′-GTTGTCATGGATGACCTTGGCC-3′.

 

IL-6-R-F: 5′-GCCGTGTTACTGGTGAGGAA-3′.

 

IL-6-R-R: 5′-AACTGGCAGAAAAACCGCTGC-3′.

 

TNFα-R-F 5′-CCCGAGTCTCAACCCTCAAC-3′.

 

TNFα-R-R 5′-GTTCCTTCAAGCTCCCCCTC-3′.

 

VEGFR-2-F 5′-CTGGATTCGTGGAGGAGAAATC-3′.

 

VEGFR-2-R 5′-GAGATGCTCCAAGGTCAGAAAG-3′.

Aortas and periovarian adipose tissue were homogenized in a Tissue-Lyser (Qiagen) and total RNA was extracted using the Qiagen RNeasy Fibrous (aorta) or Lipid (adipose) Tissue kit and quantified using a Nanodrop spectrophotometer (Thermo Scientific). First-strand cDNA was synthesized from total RNA using the Improm-II reverse transcription kit (Promega) and quantitative real-time PCR was performed using the CFX Connect Real-Time PCR Detection System (Biorad) using target specific primers (Online Resource 1). PCR reactions using iTaq Universal SYBR Green SMX (Biorad), thermal conditions, and melt curve analysis were performed as previously described [4 (link)]. GAPDH was used as an internal control gene and messenger RNA (mRNA) expression values were calculated based on cycle thresholds (CTs) via the 2^ΔΔCT method, where ΔCT = GAPDH CT – gene of interest CT and are presented normalized to control mice, which were set at 1.

Total RNA was isolated from peanut seedlings using Tri reagent (Sigma, USA) according to the manufacturer's instructions. RNA was quantified using a ND-1000 spectrophotometer (NanoDrop), and 0.5 to 1 μg of RNA was reverse transcribed by using ImProm-II™ reverse transcription kit (Promega, USA). For quantitative PCR analysis, 5–10 fold diluted cDNA was used in a reaction mixture with QuantiFast SYBR Green PCR reaction kit (Qiagen, Germany) and real time quantification was performed using Real-Time iQ5 Cycler (Bio-Rad, USA). Two to three biological samples for each treatment were processed in triplicates. Ah-actin was used as an internal control and relative fold change was determined by 2^−ΔΔCt method (Livak and Schmittgen, 2001 (link)). The real time primers used in the present study were previously reported by Yang et al. (2013 (link)) and Tiwari et al. (2015 (link)) and are given in Supplementary Table 4.

Total RNA was isolated using RNA isolation kit (Roche) and cDNA was prepared using ImProm-II Reverse Transcription Kit (Promega). For qRT-PCR, 0.5 ng of cDNA was analyzed using Applied Biosystem's Power SYBR Green PCR mix in Roche LightCycler. The expression levels of the mRNAs were normalized to 18S rRNA. To investigate in vivo gene expression, lungs were harvested from the SeV-infected mice and quickly frozen on dry ice. Total RNA was isolated from frozen lungs using Trizol extraction and the cDNAs were prepared using ImProm-II Reverse Transcription Kit and then subjected to qRT-PCR analyses as described above [74 (link)]. For the qRT-PCR analyses of the respective genes, the following primers were used: TDRD7-fwd: CGAGCTGTTCTGCAGTCTCA, TDRD7-rev: GCCATGGCATAGCAGGTAAT, Tdrd7-fwd: CTAAGGGCTGTCCTGCAGTC, Tdrd7-rev: AGAGTTGCCTTTGGCTTT, SeV P-fwd: CAAAAGTGAGGGCGAAGGAGAA, SeV P-rev: CGCCCAGATCCTGAGATACAGA, Ifnb-fwd: CTTCTCCGTCATCTCCATAGGG, Ifnb-rev: CACAGCCCTCTCCATCAACT, Ifit1-fwd: CAGAAGCACACATTGAAGAA, Ifit1-rev: TGTAAGTAGCCAGAGGAAGG, 18S-fwd: ATTGACGGAAGGGCACCACCAG, 18S-rev: CAAATCGCTCCACCAACTAAGAACG.