Amaxa mouse neuron nucleofector kit
The Amaxa Mouse Neuron Nucleofector Kit is a laboratory equipment designed for the transfection of mouse neurons. It facilitates the introduction of nucleic acids, such as DNA or RNA, into mouse neuronal cells using electroporation technology.
Lab products found in correlation
14 protocols using amaxa mouse neuron nucleofector kit
Transfection of Neuronal Cell Lines
Neuron-to-Neuron Protein Transfer Assay
Isolating Cerebellar Granule Neurons
Transfection of Hippocampal Neurons with BDNF
Neuron-to-Neuron Protein Transfer Assay
Transfection of Cells with Akt Kinase
NF-κB Reporter Assay in Postnatal Mouse Neurons
Hdac3 knockdown in cortical neurons
short hairpin RNA (shRNA) clone (TRCN0000039391, 5’ CCGGGTGTTGAATATGTCAAGAGTTCTCGAGAACTCTTGACATATTCAACACTTTTTG 3′; Sigma) and Non-Target shRNA Control Vector (Sigma) were introduced into immature primary cortical neurons (E17) using the Amaxa mouse Neuron Nucleofector kit as directed by the manufacturer (Lonza). On Day 6, HDAC3 knockdown was confirmed by Real-time RTPCR and whole-cell lysate Western blots.
Neuronal Culture and Differentiation Protocols
Plasmid and siRNA Transfection in Cell Lines
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!