Pfu dna polymerase

All synthetic DNA oligonucleotides used for cloning and library were purchased from Integrated DNA Technologies (Coralville, IA). Miniprep plasmid DNA, polymerase chain reactions (PCR), restriction enzyme digestion, ligation and agarose gel electrophoresis were performed according to Sambrook et al.41
Pfu DNA polymerase was obtained from Fermentas used for regular PCR and the QuikChange Multi kit was purchased from Agilent Technologies used for site-directed mutagenesis. All restriction enzymes were obtained from Fermentas or New England Biolabs. T4 DNA ligase was obtained from Life Technologies. PCR and digestion products were purified with the QIA quick gel extraction kit (QIAGEN, Valencia, CA) or GeneJET gel extraction kit (Fermentas) according to the manufacturer’s instructions. All sequencing was performed at the Molecular Biology Service Unit at the University of Alberta or University Core DNA Services at the University of Calgary. All filters for fluorescence imaging were purchased from Chroma Technology (Rockingham, VT), Omega Filters (Brattleboro, VT), or Semrock (Rochester, NY).

In order to characterize the 20 isolates obtained from the forest soil using ARDRA, genomic DNA was extracted from the actively-growing cultures grown in LB broth, followed by total DNA extraction using the CTAB method. The DNA concentration was estimated, and the purity was determined using agarose gel electrophoresis. Appropriately diluted (20 ng.µL^− 1) DNA was used for the amplification of the 16 S rDNA gene. The forward and reverse primers used were: 27f AGAGTTTGATCCTGGCTCAG and 1492r ACGGYTACCTTGTTACGACTT. The PCR reactions were performed in 20 µL PCR mixture, including 1X Taq buffer, 2.5 mM MgCl₂, 0.5 µM of forward and reverse primers each, 0.25 mM dNTP mixture, and 3 U of Pfu DNA Polymerase (all from Fermentas, USA). The PCR conditions were: initial denaturation at 95 °C for 5 min; 35 cycles of denaturation at 95 °C, each for 1 min; annealing at 55 °C for 1 min; primer extension at 72 °C for 1 min followed by the final extension at 72 °C for 10 min. Amplification was performed in BioRad T100 PCR. The presence of the 1.5-kb PCR product size was visualized using 1.2 % agarose gel electrophoresis.

All EAEC samples were grown in 5 ml Luria-Bertani (LB) broth medium[10 (link)]. The genomic DNA was extracted using the phenol-chloroform method[10 (link)]. PCR amplification of aap gene was carried out using specific primers (aap-forward: CATGCCATGGCAA TGAAAAAAATTAAG and aap-reverse: GCTCTAG AGCTTTAACCCATTCGG), which were designed based on the aap gene sequence of EAEC 042 strain (GenBank accession no. NC_017627.1). PCR reactions were set in 50-µl volume containing 2 µl DNA template, 5 µl 10× reaction buffer, 2 µl dNTPs (10 mM), 2 µl MgCl₂ (50 mM), 2 µl of each primer (10 pmol), and 1 U pfu DNA polymerase (Fermentas, Germany). The PCR conditions included an initial denaturation at 94°C for 3 min, followed by 30 cycles at 94°C for 60 s, 55°C for 60 s and 72°C for 60 s, with a final extension step at 72°C for 8 min. After the amplification of aap gene, 5 µl of the samples was subjected to electrophoresis on 1% agarose gel (Sigma, USA) to confirm the presence of the amplified products.

To identify microbes present in each sample, 454 pyrosequencing of the 16S rRNA gene were carried out. A region approximately 526 bp covering the V1–V3 region of 16S rRNA gene in each sample was amplified using the 27F and 533R primers containing the A and B adaptors (454 Life Sciences).^{17,18 (link)} The reverse primer (A-533R) had an A adaptor with a ten base sample unique barcode sequence.
Polymerase chain reaction (PCRs) were carried out in triplicate in a 50 μl reaction system containing 0.6 μM each of the primer, approximately 5 ng of the template DNA, 1× PCR buffer, 2.5 U of Pfu DNA polymerase (MBI Fermentas, USA). Negative controls were performed without addition of the template DNA. The amplification program is described elsewhere.^{18 (link)} After amplification, the PCR products of the same sample were pooled and purified using a DNA gel extraction kit (Axygen, China).
Next, the concentration of each PCR product was determined and the quality was controlled.^{18 (link)} The working pool was a mixture of an equi-molar ratio of each amplicon which was subjected to emulsion PCR to generate amplicon libraries, as recommended by 454 Life Sciences. Amplicon pyrosequencing was performed from the A-end using 454/Roche A sequencing primer kit on a Roche Genome Sequencer GS FLX Titanium platform (Majorbio Bio-Pharm Technology Co., Ltd, Shanghai, China).

Sequences encoding GSase (Rv1212c; glgA), ADP-Glc PPase (Rv1213; glgC), UDP-Glc PPase (Rv0993; galU) and Tre-6P Sase (Rv3490; otsA) from Mtb H37Rv were amplified by PCR using genomic DNA as the template. Genomic DNA was kindly provided by Drs. Marisa Romano and Fabiana Bigi, from INTA Castelar (Argentina). Primers are listed in Supplemental Table I and were designed for each gene using available genomic information [38] (link), [39] (link) in the GenBank database (http://www.ncbi.nlm.nih.gov/Genbank/index.html). PCR reaction mixtures (50 μl) contained 100 ng of genomic DNA, 2 pg of each primer; 0.2 mM of each dNTP; 2.5 mM Mg²⁺, 5% (v/v) DMSO and 1 U Pfu DNA polymerase (Fermentas). Standard conditions of PCR were used for 30 cycles: denaturation at 94 °C for 1 min; annealing at 74 °C for glgC, 71 °C for glgA and 70 °C for galU and otsA, for 30 s, and extension at 72 °C for 3 min, with a final extension of 10 min at 72 °C. PCR reaction mixtures were resolved in 1% (w/v) agarose gels and PCR products were purified by means of Wizard SV gel & PCR Clean Up kits (Promega). The amplified genes [previously treated with Taq polymerase (Fermentas) and dATP] were cloned into the T-tailed plasmid pGEM-TEasy.