Etanercept (Shanghai Sunshine Guojian Pharmaceutical Co., Ltd., China); BAFF (R&D Systems, USA); TNF-α (novoprotein, China); fetal bovine serum (Zhejiang Tianhang Biotechnology, China). TRAF2(C-20), TRAF2-AF647, P-p38 (Santa Cruz Biotechnology, USA); p38 (Abcam, USA); p65 (Cell signaling Technology, USA); P-p65 (affinity Biosciences, USA); FITC Rat Anti-Mouse CD19, APC Mouse Anti-Human CD27, FITC Mouse Anti-Human CD138, PE Rat Anti-Mouse IgM, PE Mouse Anti-Human CD19 (BD Pharmingen, San Diego, CA, USA); TNFRI-APC, IgD-BV421 (BioLegend, San Diego, CA, USA); CD120b (TNF-RII)-APC (Miltenyi Biotec GmbH, Germany); fetal bovine serum (Zhejiang Tianhang Biotechnology Co., Ltd, China); RPMI-1640 medium (HyClone, USA); Human BAFF ELISA kit, Human TNF-α ELISA kit (Nanjing Fcmacs Biotechnology Co., Ltd, China); Human lymphocyte separation solution, Mice lymphocyte separation solution (Shenzhen Dakco Biotechnology Co., Ltd, China); Cell Counting Kit (CCK-8/WST-8) Cell Proliferation and Activity Assay Kit: Biolite Biotech Trading Partners (Encinitas, CA, USA).
Fetal bovine serum (fbs)
Manufactured by Zhejiang Tianhang Biotechnology
Sourced in China, United States, Germany
Fetal bovine serum is a cell culture supplement derived from the blood of bovine fetuses. It is a complex mixture of proteins, growth factors, hormones, and other components that support the growth and proliferation of a variety of cell types in vitro.
Automatically generated - may contain errors
Lab products found in correlation
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (21 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (11 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (11 mentions)
Dulbecco s modified eagle s medium, by Thermo Fisher Scientific (5 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (5 mentions)
Hyclone, by GE Healthcare (4 mentions)
Penicillin, by Beyotime (4 mentions)
Streptomycin, by Beyotime (4 mentions)
Penicillin streptomycin, by Solarbio (4 mentions)
Penicillin streptomycin, by Beyotime (4 mentions)
Penicillin, by Solarbio (3 mentions)
Streptomycin, by Solarbio (3 mentions)
Rpmi 1640 medium, by Zhejiang Tianhang Biotechnology (3 mentions)
Penicillin, by Thermo Fisher Scientific (3 mentions)
Streptomycin, by Thermo Fisher Scientific (3 mentions)
Terephthalic acid h2bdc, by Tianjin Guangfu (3 mentions)
Dmem f12, by Thermo Fisher Scientific (3 mentions)
Penicillin, by Zhejiang Tianhang Biotechnology (3 mentions)
Trypsin, by Thermo Fisher Scientific (3 mentions)
Rpmi 1640 medium, by Solarbio (3 mentions)
149 protocols using fetal bovine serum (fbs)
1
Etanercept Modulates BAFF-Induced B-cell Signaling
2
Regulation of Lung Cancer Cell Lines by circCDR1as and SOX5
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human lung cancer cell lines (A549, Calu‐3, CAEP and SK‐MES‐1) and human bronchial epithelioid cells (HBE) were purchased from BeNa Culture Collection (Beijing, China) and cultured in Dulbecco's Modified Eagle Medium (DMEM) (Solarbio, Beijing, China) containing 10% fetal bovine serum (Zhejiang Tianhang Biotechnology, Huzhou, China) and 1% penicillin‐streptomycin solution (Procell, Wuhan, China).
The overexpression vectors of circCDR1as and SOX5 were generated with pcDNA3.1 vector (pcDNA) (YouBio, Changsha, China). The pcDNA vector was used as a negative control. The short interfering RNA (siRNA) for circCDR1as (si‐circCDR1as#1, 5′‐GCAAUAUCCAGGGUUUCCGAU‐3′; si‐circCDR1as#2, 5′‐UGUCUGCAAUAUCCAGGGUUU‐3′), siRNA negative control (si‐NC, 5′‐UUCUCCGAACGUGUCACGU‐3′), miR‐219a‐5p mimic (miR‐219a‐5p, 5′‐UGAUUGUCCAAACGCAAUUCU‐3′), mimic negative control (miR‐NC, 5′‐UUCUCCGAACGUGUCACGUTT‐3′), miR‐219a‐5p inhibitor (anti‐miR‐219a‐5p, 5′‐AGAAUUGCGUUUGGACAAUCA‐3′) and inhibitor negative control (anti‐NC, 5′‐CAGUACUUUUGUGUAGUACAA‐3′) were generated by Fulengen (Guangzhou, China). A549 and Calu‐3 cells were transfected with these conducted oligonucleotides or vectors using Lipofectamine 3000 (Thermo Fisher, Wilmington, DE, USA) for 24 hours.
The overexpression vectors of circCDR1as and SOX5 were generated with pcDNA3.1 vector (pcDNA) (YouBio, Changsha, China). The pcDNA vector was used as a negative control. The short interfering RNA (siRNA) for circCDR1as (si‐circCDR1as#1, 5′‐GCAAUAUCCAGGGUUUCCGAU‐3′; si‐circCDR1as#2, 5′‐UGUCUGCAAUAUCCAGGGUUU‐3′), siRNA negative control (si‐NC, 5′‐UUCUCCGAACGUGUCACGU‐3′), miR‐219a‐5p mimic (miR‐219a‐5p, 5′‐UGAUUGUCCAAACGCAAUUCU‐3′), mimic negative control (miR‐NC, 5′‐UUCUCCGAACGUGUCACGUTT‐3′), miR‐219a‐5p inhibitor (anti‐miR‐219a‐5p, 5′‐AGAAUUGCGUUUGGACAAUCA‐3′) and inhibitor negative control (anti‐NC, 5′‐CAGUACUUUUGUGUAGUACAA‐3′) were generated by Fulengen (Guangzhou, China). A549 and Calu‐3 cells were transfected with these conducted oligonucleotides or vectors using Lipofectamine 3000 (Thermo Fisher, Wilmington, DE, USA) for 24 hours.
3
Investigating TACR1 and circ_0091579 in HCC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCC cell lines SNU-387 and Huh7 cells, and liver epithelial cell line THLE-2 cells were provided via Procell (Wuhan, China) and grown in RPMI-1640 medium (Procell) plus 10% fetal bovine serum (Zhejiang Tianhang Biotechnology, Huzhou, China) and 1% penicillin/streptomycin (Thermo Fisher, Waltham, MA, USA) in 5% CO2 at 37°C.
TACR1 overexpression vector (pc-TACR1) was generated by cloning TACR1 sequence into pcDNA3.1 vector in our laboratory, and the pcDNA3.1 vector (Thermo Fisher) acted as negative control (pc-NC). siRNA for circ_0091579 (si-circ_0091579-1, 5ʹ-GCACAUUAACCAGAGGCCUUU-3ʹ; si-circ_0091579-2, 5ʹ-CAUUAACCAGAGGCCUUUGAA-3ʹ), negative control of siRNA (si-NC, 5ʹ-AAGACAUUGUGUGUCCGCCTT-3ʹ), miR-940 mimic (5ʹ-AAGGCAGGGCCCCGCUCCCC-3ʹ), negative control of mimic (miRNA NC, 5ʹ-ACGUGACACGUUCGGAGAATT-3ʹ), miR-940 inhibitor (5ʹ-GGGGAGCGGGGCCCUGCCUU-3ʹ), and negative control of inhibitor (inhibitor NC, 5ʹ-CAGUACUUUUGUGUAGUACAA-3ʹ) were generated via Ribobio (Guangzhou, China). The vectors or these oligonucleotides (30 nM) were transfected into SNU-387 and Huh7 cells via Lipofectamine 2000 (Thermo Fisher) for 24 h.
TACR1 overexpression vector (pc-TACR1) was generated by cloning TACR1 sequence into pcDNA3.1 vector in our laboratory, and the pcDNA3.1 vector (Thermo Fisher) acted as negative control (pc-NC). siRNA for circ_0091579 (si-circ_0091579-1, 5ʹ-GCACAUUAACCAGAGGCCUUU-3ʹ; si-circ_0091579-2, 5ʹ-CAUUAACCAGAGGCCUUUGAA-3ʹ), negative control of siRNA (si-NC, 5ʹ-AAGACAUUGUGUGUCCGCCTT-3ʹ), miR-940 mimic (5ʹ-AAGGCAGGGCCCCGCUCCCC-3ʹ), negative control of mimic (miRNA NC, 5ʹ-ACGUGACACGUUCGGAGAATT-3ʹ), miR-940 inhibitor (5ʹ-GGGGAGCGGGGCCCUGCCUU-3ʹ), and negative control of inhibitor (inhibitor NC, 5ʹ-CAGUACUUUUGUGUAGUACAA-3ʹ) were generated via Ribobio (Guangzhou, China). The vectors or these oligonucleotides (30 nM) were transfected into SNU-387 and Huh7 cells via Lipofectamine 2000 (Thermo Fisher) for 24 h.
4
Synthesis and Characterization of Zinc-Based MOF
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Zinc nitrate hexahydrate (Zn(NO3)2·6H2O) was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. (Shanghai, China). Terephthalic acid (H2BDC) and dimethyl sulfoxide (DMSO) were obtained from Tianjin Guangfu Fine Chemical Research Institute (Tianjin, China). Triethylamine (TEA) was acquired from Tianjin Fuchen Chemical Reagent Factory (Tianjin, China). Trichloromethane (CHCl3) and N,N-Dimethylformamide (DMF) were got from Beijing Chemical Factory (Beijing, China). ORI was purchased from Nantong Feiyu Biotechnology Co., Ltd. (Nantong, China). Methanol (Chromatographic reagent grade) was obtained from Thermo Fisher Scientific (Shanghai, China). PBS and penicillin-streptomycin mixture were purchased from Solarbio (Beijing, China). High-glucose Dulbecco’s Modified Eagle Medium (DMEM) was obtained from Corning (Manassas, VA, USA). Fetal bovine serum was available from Zhejiang Tianhang Biotechnology Co., Ltd. (Zhejiang, China). 3-(4,5-dimethylthiazol-2-yl)-2,5-dipheny-ltetrazolium bromide (MTT) was obtained from Beijing Biodee Biotechnology Co., Ltd. (Beijing, China). 4′,6-diamidino-2-phenylindole (DAPI) and Annexin V-FITC Apoptosis Detection Kit were purchased from Shanghai Beyotime Biotechnology Co., Ltd. (Shanghai, China). All chemicals were of analytical grade or higher.
5
Antioxidant Pretreatment Modulates PCB Exposure
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HUVECs and human monocytic cells (THP-1 cells) were purchased from KeyGEN Biotech Co., Ltd. HUVECs and THP-1 cells were grown in Roswell Park Memorial Institute 1640 medium supplemented with 10% fetal bovine serum (Zhejiang Tianhang Biotechnology Co., Ltd.), penicillin, and streptomycin at 37°C in a 5% incubator. In addition, the medium for THP-1 cells was supplemented with
. HUVECs ( ) were seeded in six-well culture plates overnight and exposed to PCB29-pQ for 24 h for subsequent experimental testing. HUVECs were pretreated with antioxidants ( VC, VE, NAC, PEG-SOD, PEG-CAT, or GSH-MEE) for 1 h, followed with PCB29-pQ exposure for 6 h for subsequent experimental testing. Parallel control cultures received equal volumes of dimethyl sulfoxide (DMSO). Each experiment was independently repeated at least three times.
. HUVECs ( ) were seeded in six-well culture plates overnight and exposed to PCB29-pQ for 24 h for subsequent experimental testing. HUVECs were pretreated with antioxidants ( VC, VE, NAC, PEG-SOD, PEG-CAT, or GSH-MEE) for 1 h, followed with PCB29-pQ exposure for 6 h for subsequent experimental testing. Parallel control cultures received equal volumes of dimethyl sulfoxide (DMSO). Each experiment was independently repeated at least three times.
6
Khat Treatment Effects on MDA-MB-231 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MDA-MB-231 cells were cultured in Dulbecco's modified Eagle's medium (HyClone; GE Healthcare Life Sciences) with 10% fetal bovine serum (Zhejiang Tianhang Biotechnology Co., Ltd., Hangzhou, Zhejiang, China) and maintained in a humidified incubator at 37°C with 5% CO2. When 60–70% confluence was achieved, the cells were treated with 400 µg/ml khat and left to culture for 4, 8, 16, or 24 h at 37°C. The cells in the control group were not treated with khat.
7
Culturing Breast Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The breast cancer cell lines MCF-7 and MCF-7/ADR (adriamycin-resistant) were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The cells were cultured in DMEM (Gibco, Suzhou, China) supplemented with 10% heat-inactivated fetal bovine serum (Zhejiang TianHang Biotechnology Co. LTD, Hangzhou, China) 100 units/ml penicillin and 100 μg/ml streptomycin (KeyGen Biotech, Jiangsu, China) in a humidi ed atmosphere at 37 °C under 5% CO2. The MCF-7/ADR cells were cultured in the above-mentioned media that were additionally supplemented with 1 mg/mL ADR (KeyGen Biotech, Nanjing, China) to maintain the drug-resistant phenotype.
8
Pumpkin Peel Chromium Extraction and Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh pumpkin peel was obtained from Laiyang Mengyu Co., Ltd. (Yantai, China). CrCl3·6H2O (analytical grade) was obtained by Tianjin Kaitong chemical reagent Co., Ltd. (Shanghai, China). Trifluoroacetic acid (TFA) and insulin were provided by Sigma-Aldrich Co., Ltd. (St. Louis, MO, USA). α-Glucosidase, 4-nitrophenyl-α-D-glucopyranoside (PNPG), penicillin-streptomycin, and albumin bovine were purchased from Beijing Solarbio Technology Co., Ltd. (Beijing, China). Acarbose and monosaccharide standards (rhamnose, arabinose, galactose, glucose, mannose, xylose, fructose, galacturonic acid, and glucuronic acid) were obtained from Shanghai Yuanye Bio-Technology Co., Ltd. (Shanghai, China). Sodium acetate, anhydrous (electrochemical grade), and SS254-500 sodium hydroxide solution were purchased from Thermo Fisher Scientific (Sunnyrale, CA, USA). High-glucose DMEM medium was obtained from Wuhan Servicebio Technology Co., Ltd. (Wuhan, China). Fetal bovine serum was purchased from Zhejiang Tianhang Biotechnology Co., Ltd. (Huzhou, China). Trivalent chromium standard solution was supplied by Beijing Century Aoke Biotechnology Co. Ltd. (Beijing, China). All other chemicals and reagents used were of analytical grade.
9
Overexpression and Inhibition of CB1 in 3T3-L1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pcDNA3.1(+) plasmid and the CB1 inhibitor SR141716A were purchased from Qingdao Saishang Biotechnology Co., Ltd., for cell transfection according to the manufacturer’s instructions (Transfection kit: C0511). The CB1 fragment and pcDNA3.1(+) plasmid were digested by restriction endonucleases EcoRI and BamHI, and eukaryotic plasmid vectors were constructed according to the instructions of the T4DNA ligase kit (Cat No.: D7006) and plasmid extraction kit (Cat No.: D0020). The 3T3-L1 preadipocyte line was purchased from cell bank of Chinese Academy of Sciences. DMEM medium (GIBCO, Cat No.: SH30022.1, NaHCO3 1.5 g/L added) was purchased from Beijing Soleibao Co., Ltd. Fetal bovine serum (Cat No.: 11011-8611, 20%; double antibody: 1%) was purchased from Zhejiang Tianhang Biotechnology Co., Ltd. The cells were cultured in a dish and divided into four groups: a negative control group (NC-OE), overexpression group (CB1-OE), negative control group (NC-inhibitor) and inhibitor (CB1-inhibitor). A total of 75–80% of the fusion cells were transfected by the liposome transfection technique. The CB1 inhibitor was added at a concentration of 0.025 pmol/well. The cells were collected and analyzed 48 h after transfection (Lian et al., 2016 (link)).
10
Culturing Gastric Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Normal cell lines for the stomach epithelium (GSE-1) and Gastric cancer cells (BGC-823, AGS, MKN-45) were purchased from Wuhan Cell Bank, and have been raised in RPMI 1640 media (Beijing Solarbio Science & Technology Co., Ltd.) with a fetal bovine serum content of 10% (Sijiqing, Zhejiang Tianhang Biotechnology Co., LTD) and incubated at 37°C with 5% CO2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!