Kapa hyper library preparation kit
The KAPA Hyper Library Preparation Kit is a laboratory product designed for the preparation of DNA libraries for next-generation sequencing. It provides a streamlined workflow for the construction of high-quality sequencing libraries from various DNA input sources.
Lab products found in correlation
26 protocols using kapa hyper library preparation kit
Kapa Hyper Library Preparation for cfDNA Sequencing
Tumor DNA Extraction and Sequencing for Mutation Analysis
Five sections (10 μm thick) that were cut from paraffin-embedded tumor tissue blocks were used per analysis. To obtain maximal tumor DNA, we chose tumor-rich paraffin block specimens whose tumor components were greater than at least 30%. DNA in the collected tissue samples was extracted using the QIAamp DNA FFPE Tissue Kit (Cat No. 56404, Qiagen) following the manufacturer’s protocol. DNA from each sample was eluted in 50 μL of ATE buffer (included in the kit).
Total DNA was quantified by using the Qubit dsDNA HS Assay kit (Invitrogen), libraries were constructed using the KAPA Hyper library preparation kit (KAPA, KK8504) following Illumina (San Diego, CA) protocols. Sequencing was performed to examine the mutation in KRAS (all exons), NRAS (all exons), BRAF (all exons) through a NovaSeq 6000 sequencing system (Illumina).
Chromatin Immunoprecipitation Sequencing Protocol
CRISPR Library Sequencing Preparation
Exome Sequencing of Sheared gDNA
Ancient DNA Shotgun Sequencing Workflow
Whole Genome Sequencing Library Preparation
RNA-Seq Profiling of miRNA and mRNA in CSF Samples
Whole Exome Sequencing and Sanger Validation
For family 3 (P3, P4 and their unaffected brother), WES was performed essentially by the same method, but library preparation was done using KAPA Hyper library preparation Kit (Kapa Biosystems, Wilmington, Ma, USA) and SeqCap EZ MedExome assay (Roche Nimblegen) was used for target enrichment.
Sanger sequencing was performed with primers specific for PYROXD1 exon 5 (CAGTGGGAAAGTGAGATTCATTT and ATTACGGATTCCACAAGAGCT) and exon 10 (CCATGGAAATTCAGCTCAGGT and AACAACTGTGCTAGCTTCCT).
Targeted Genomic Library Preparation
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!