Hyperscript rt master mix

In order to analyze TLR5 expression, total RNA was extracted with the Qiagen RNeasy kit (Qiagen) according to the manufacturer's instructions. RNA concentrations were determined with a MaestroNano Micro-Volume Spectrophotometer (Maestrogen, Las Vegas, NV, USA). cDNA was synthesized from 2 μg of total RNA using Hyperscript RT master mix (GeneAll, Seoul, Korea) using an Oligo (dT) primer (Invitrogen) at 42°C for 1 h.
Quantitative real-time PCR was performed on the rotor-gene system (Qiagen) using the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen). PCR amplification was performed using the following primer sets: TLR5 5′-ccttacagcgaacctcatccac-3′, 5′-tccactacaggaggagaagcga-3′, β-actin 5′-gacttccctactctcatctgct-3′, 5′-cttattctaggggcagagggt-3′. Sample normalization was performed using the human β-actin gene as an endogenous control. For each sample, the relative abundance of target mRNA was calculated from the C_Δt values of the target and endogenous β-actin reference genes using the 2^−ΔΔ cycle threshold (Ct) method.

Cells were treated with 1 μM ATRA or DMSO for 24 h and then stimulated with flagellin from S. typhimurium for 4 h. Total RNA extraction was performed using a Qiagen RNAeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. RNA concentrations were determined with a MaestroNano Microvolume spectrophotometer (Maestrogen, Las Vegas, NV, USA). cDNA synthesis was performed by reverse transcription using Hyperscript RT master mix (GeneAll, Seoul, Korea) with an Oligo (dT) primer (Invitrogen) and 2 μg of total RNA at 42°C for 1 h. Quantitative real-time PCR was performed on the Rotor-gene system (Qiagen) using the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen). PCR amplification was performed using following primer sets: TNF-α 5′-tgagcactgaaagcatgatcc-3′, 5′-ggagaagaggctgag gaaca-3′; IL-1β 5′-gggataacgaggcttatgtgc- 3′, 5′-aggtggagagctttcagttca-3′; and β-actin 5′-caccattggcaatga gcggttc-3′, 5′-aggtctttgcggatgtccacgt-3′. Normalization of target gene expression levels was performed using the human β-actin gene as an endogenous control. For each sample, the relative abundance of target mRNAs was calculated from the C_Δt values of the target and β-actin genes based on the 2^−ΔΔcycle threshold (Ct) method.

The total RNA was extracted and converted into cDNA using HyperScript RT Mastermix (GeneAll Biotechnology, Seoul, Korea). The cDNA was amplified in a MyCycler Thermal Cycler (Bio-Rad, Hercules, CA) using CXCR4 forward primer: TTCTACCCCAATGACTTGTG and reverse primer: ATGTAGTAAGGCAGCCAACA. The cycling conditions involved 35 cycles for 30 s at 94 °C, 60 °C, and 72 °C. The amplified PCR products were visualized on a 1% agarose gel stained with ethidium bromide.

Total RNA was extracted using the Qiagen RNAeasy Mini Kit (Qiagen, Hilden, Germany) and reverse transcribed into cDNA with Hyperscript RT master mix (GeneAll, Seoul, Korea) using an Oligo (dT) primer (Invitrogen, Gibco BRL, MD, USA) according to the manufacturer’s instructions. Then, qPCR was performed on a Rotor-gene system (Qiagen) using the Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen, Corp., Carlsbad, CA, USA). The following primer sets were used: Hsp90-α 5′-CGTCTTCGGAAACATGGCTT-3′, 5′-CGGTTTGACACAACCACCTT-3′, IL-1β 5′-GGGATAACGAGGCTTATGTGC-3′, 5′-AGGTGGAGAGCTTTCAGTTCA-3′, caspase-1 5′-CGATTTTCATTTGAGCAGCCA-3′, 5′-ATCTCTTCACTTCCTGCCCAC-3′ and β-actin 5′-CACCATTGGCAATGAGCGGTTC-3′, 5′-AGGTCTTTGCGGATGTCCACGT-3′. Sample normalization was performed using the human β-actin gene as an endogenous control. For each sample, the relative abundance of target mRNA was calculated from the C△t values of the target and endogenous β-actin reference genes using the 2−△△cycle threshold (Ct) method.