Anti phgdh

Manufactured by Proteintech

Anti-PHGDH is a laboratory antibody product that specifically targets the PHGDH (phosphoglycerate dehydrogenase) protein. PHGDH is an enzyme involved in the serine biosynthesis pathway. This antibody can be used to detect and study the PHGDH protein in various experimental applications.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

PHGDH (3 citations) Anti-TM (2 citations)

6 protocols using anti phgdh

Protein Expression Profiling by Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed with cell lysis buffer (Cell Signaling Technology, Cat#9803), and cell lysate was clarified by centrifugation, according to the manufacturer’s protocol. Anti-NPM1 (Proteintech, clone: 4F12A3, Cat#60096-1-Ig), Anti-PHGDH (Proteintech, polyclonal, Cat#14719-1-AP), and Anti-TMEM134 (Invitrogen, polyclonal Cat#PA5-60492) were used for western blotting. Actin (Invitrogen, clone: BA3R, Cat#MA5-15739-HRP) was used to monitor equal loading.

Wu B., Chen X., Pan X., Deng X., Li S., Wang Z., Wang J., Liao D., Xu J., Chen M., Zhao C., Xue Z., Wang Y., Niu T., Lin J., Chen L., Liu Y, & Chen C. (2023). Single-cell transcriptome analyses reveal critical roles of RNA splicing during leukemia progression. PLOS Biology, 21(5), e3002088.

+ Open protocol

+ Expand

Whole-Cell Lysis for Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole-cell lysates were prepared in a strong cell lysis buffer (1% SDS, 50 mM Tris–HCl pH 8, 10 mM EDTA, and fresh protease inhibitor cocktail) and ultrasonicated. The cell lysate was quantified, 1 × loading buffer was added, and the cells were boiled for 10 min. Samples were subjected to SDS-PAGE to detect proteins using specific antibodies, including anti-eIF3i (ProteinTech, 1:2000), anti-PHGDH (ProteinTech, 1:2000), and anti-GAPDH (Affinity, 1:5000). Images were captured using a ChemiDoc MP Imaging System (Bio-Rad).

Zhang Y., Wan X., Yang X., Liu X., Huang Q., Zhou L., Zhang S., Liu S., Xiong Q., Wei M., Qiu L., Zhang B, & Han J. (2023). eIF3i promotes colorectal cancer cell survival via augmenting PHGDH translation. The Journal of Biological Chemistry, 299(9), 105177.

+ Open protocol

+ Expand

Comprehensive Protein Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were used: anti-CDK1 (abcam, 2546 ab133327), anti-cyclin D1 (CST, 2922), anti-CDK6 (Abcam, ab151247), anti-cyclin E2 (CST, 4132), anti-PHGDH (Proteintech, 14,719–1-AP), anti-PSPH (Proteintech, 14,513–1-AP), anti-Ki-67 (Abcam, ab15580), anti-SLC1A4 (Proteintech, 13,067–2-AP), anti-p53(CST, 9282), anti-MDM2 (CST, 86,934), anti-hnRNPA2B1 (Proteintech, 14,813–1-AP), anti-Mettl3 (Proteintech, 15,073–1-AP), anti-GAPDH (CST, 2118), anti-Flag (CST, 2368), HRP goat anti-rabbit IgG (Biodragon, BF03008), HRP goat anti-mouse IgG (Biodragon, BF03001), CoraLite488-conjugated goat anti-rabbit IgG (Proteintech, SA00013-2), CoraLite594-conjugated goat anti-mouse IgG (Proteintech, SA00013-3), Nutlin-3 was purchased from Sigma (Shanghai, China).

Liu X., Liu Y., Liu Z., Lin C., Meng F., Xu L., Zhang X., Zhang C., Zhang P., Gong S., Wu N., Ren Z., Song J, & Zhang Y. (2021). CircMYH9 drives colorectal cancer growth by regulating serine metabolism and redox homeostasis in a p53-dependent manner. Molecular Cancer, 20, 114.

+ Open protocol

+ Expand

Transfection and Western Blot for PHGDH Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were transfected with siRNA using Lipofectamine 3000 reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) along with the manufacturer's procedure within 24 h after seeded in the 6‐well culture plates. RNA and total protein were extracted 48 or 72 h after transfection for further analysis. The efficiency of transfection was validated by western blot and real‐time qPCR. Western blot was conducted as previously described.²¹ Antibodies used in the present study were: anti‐PHGDH (Proteintech, 14719‐1‐AP), anti‐β‐actin (Proteintech, 60008‐1‐Ig), anti E‐cadherin (Proteintech, 20874‐1‐AP), anti‐vimentin (Proteintech, 60330‐1‐Ig), anti‐caspase‐3 (Proteintech, 66470‐2‐Ig), anti‐Zeb1 (CST, 70512T), anti‐β‐catenin (CST, #9562), anti‐N‐cadherin (abcam, ab76011), anti‐Snail (CST, 3879T), anti‐caspase‐9 (Proteintech, 66169‐1‐Ig), anti‐Bax (Proteintech, 50599‐2‐Ig), and anti‐Bcl‐2 (Proteintech, 60178‐1‐Ig). Real‐time qPCR was conducted along with the manufacturer's protocols. Primers used were PHGDH (Forward: GAATGATCATGTGCCTGGC; Reverse: GTTCCCATGAACTTCTTCCG).

Zhai L., Yang X., Cheng Y, & Wang J. (2023). Glutamine and amino acid metabolism as a prognostic signature and therapeutic target in endometrial cancer. Cancer Medicine, 12(15), 16337-16358.

+ Open protocol

+ Expand

Immunohistochemical Analysis of PHGDH in EC

Check if the same lab product or an alternative is used in the 5 most similar protocols

The tissues of EC and para‐carcinoma are from patients treated at the Department of Obstetrics and Gynecology of Peking University People's Hospital (PKUPH) (Beijing, China). The informed consents have been obtained from the patients. The study was approved by the Ethics Committee of the People's Hospital, Peking University (2020PHB424‐01). The immunohistochemistry (IHC) was performed as previously described²⁰ with anti‐PHGDH (Proteintech, 14719‐1‐AP). Percentage of the positive cells were analyzed by ImageJ software (Rawak Software, Inc. Germany). Statistical analysis was performed using Student's t‐test by GraphPad Prism 8 (GraphPad Software Inc., La Jolla, CA, USA). The p values were provided.

Zhai L., Yang X., Cheng Y, & Wang J. (2023). Glutamine and amino acid metabolism as a prognostic signature and therapeutic target in endometrial cancer. Cancer Medicine, 12(15), 16337-16358.

+ Open protocol

+ Expand

PERK Signaling Pathway Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed in RIPA buffer (Thermo Fisher) with protease and phosphatase inhibitors (Cell Signaling Technologies). Anti-PERK (C33E10), anti-PHB1, anti-XBP1s (E9V3E), anti-Tri-Methyl-Histone H3 Lys27 (C36B11), and anti-Histone H3 (D1H2) were all purchased from Cell Signaling Technologies. Polyclonal antibody p-PERK(T980) was purchased from Bioss (BS-3330R). Anti-JMJD3 was purchased from Abcepta. Anti-PHGDH and anti-PSAT1 antibodies were purchased from Protein Tech. Total OXPHOS rodent antibody cocktail was purchased from Abcam. Anti-ATF4 (C-20) was purchased from Santa Cruz Biotechnology. Anti-β-Actin was purchased from Sigma-Aldrich. Primary antibody staining was followed by peroxidase-linked secondary antibody and ECL immunoblot detection (Bio Rad). Immunoblots for p-PERK(T980) and PERK was performed using a phos-tag-based acrylamide gel (FUJIFILM Wako Chemicals).

Raines L.N., Zhao H., Wang Y., Chen H.Y., Gallart-Ayala H., Hsueh P.C., Cao W., Koh Y., Alamonte-Loya A., Liu P.S., Ivanisevic J., Lio C.W., Ho P.C, & Huang S.C. (2022). PERK is a critical metabolic hub for immunosuppressive function in macrophages. Nature immunology, 23(3), 431-445.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!