Pneumococcal pneumonia was induced by either serotype 2 S. pneumoniae (D39), a non-encapsulated mutant strain (isogenic capsule locus(cps) deletion mutant D39Δcps) of D39 [11 (link),12 (link)] or a serotype 3 pneumococcal strain (ATCC 6303, American Type Culture Collection, Manassas, VA). All bacterial strains were grown for 3–6 hours to midlogarithmic phase at 37°C in Todd-Hewitt broth (Difco, Detroit, MI), supplemented with yeast extract (0.5%). Bacteria were harvested by centrifugation at 4000 rpm, and washed twice in sterile isotonic saline. Next, mice (n = 8 per strain for each time point), were inoculated with 107 colony forming units (CFU) D39, 108 CFU D39Δcps or 5 x 104 CFU serotype 3 S. pneumoniae per mouse in a 50 μl saline solution and sacrificed 6, 24 or 48 hours thereafter as described [9 (link),12 (link)]. All mice survived to the predefined endpoint in all experiments. Collection and handling of samples were done as described [9 (link),12 (link)]. In brief, blood was drawn into heparinized tubes and organs were removed aseptically and homogenised in 4 volumes of sterile isotonic saline using a tissue homogenizer (Biospec Products, Bartlesville, UK). To determine bacterial loads, ten-fold dilutions were plated on blood agar plates and incubated at 37°C for 16 hours.
Tissue homogenizer
Manufactured by Biospec
Sourced in United States
The Tissue Homogenizer is a laboratory instrument used to disrupt tissue samples in preparation for various analyses. It mechanically breaks down the tissue into a homogeneous mixture by applying high-speed shearing forces. The homogenizer allows for efficient sample processing and ensures uniform sample composition prior to further testing or experimentation.
Automatically generated - may contain errors
Lab products found in correlation
Ripa buffer, by Thermo Fisher Scientific (4 mentions)
Protease inhibitor solution, by Merck Group (3 mentions)
Hemacolor staining kit, by Merck Group (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Microtainer, by BD (2 mentions)
Tissue protein extraction reagent, by Thermo Fisher Scientific (2 mentions)
Tissue protein extraction buffer, by Thermo Fisher Scientific (2 mentions)
Atcc 6303, by American Type Culture Collection (1 mentions)
Cytocentrifugation, by Thermo Fisher Scientific (1 mentions)
T per tissue protein extraction reagent, by Thermo Fisher Scientific (1 mentions)
Goscript reverse transcription kit, by Promega (1 mentions)
Rneasy midi kit, by Qiagen (1 mentions)
Abi 7500 detection system, by Thermo Fisher Scientific (1 mentions)
Sybr green, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Centrifuge tube, by Eppendorf (1 mentions)
Cytospin 3, by Thermo Fisher Scientific (1 mentions)
Enhanced chemiluminescence kit, by Cytiva (1 mentions)
E z n a soil dna kit, by Omega Bio-Tek (1 mentions)
28 protocols using tissue homogenizer
1
Pneumococcal Pneumonia Murine Model
2
Lung Homogenization and Biomarker Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Left lungs of the second subgroup were harvested, weighed, and lung weight per body weight ratio was calculated. Then, lungs were homogenized in chilled 1.15% KCl (pH 7.45) using a tissue homogenizer (Biospec Products, Racine, WI) to yield 10% w/v tissue homogenates (Yuting et al., 2019 ). Homogenates were then used for the evaluation of interleukin (IL-4, IL-13), malondialdehyde (MDA), superoxide dismutase (SOD), and NO contents.
3
Bronchoalveolar Lavage and Lung Cytokine Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To collect bronchoalveolar lavage (BAL) fluid, the lungs were lavaged with 1 mL of Hank's balanced salt solution through an intubation tube. Total cell numbers were counted with a hemocytometer. BAL fluid was centrifuged at 1,500 rpm for 3 minutes at 4℃, and then smears of BAL cells were prepared by cytocentrifugation (Thermo, MA, USA) at 1,000 rpm for 3 minutes. All smears were stained with a Hemacolor staining kit (Merck, Darmstadt, Germany). Differential cell counts in BAL cells were done for at least 200 leukocytes, using standard hemocytologic procedures to classify macrophages, neutrophils, eosinophils, and lymphocytes. After collecting BAL fluid, one lung was removed and homogenized in 3 mL of lysis buffer T-PER@ tissue protein extraction reagent (Thermo, MA, USA) using a tissue homogenizer (Biospec Products, OK, USA). Homogenates were incubated at 4℃ for 30 minutes, then centrifuged at 2,500 rpm for 10 minutes. Supernatants were collected, passed through a 0.45 µm filter (Gelman Sciences, MI, USA), and then stored at -70℃ for assessment of cytokine levels.
4
Quantitative Gene Expression Analysis
5
Cytokine and Oxidative Stress Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All rats were sacrificed after 12 weeks' feeding and blood samples were obtained from heart. Liver, heart, spleen, lung, kidney, intestine, and pancreas tissues were dissected immediately and collected for cytokines and histopathological analysis. Tissue samples were homogenized using a tissue homogenizer (Biospec Products, Bartlesville, OK). Homogenates were incubated at 4°C for 30 min and then centrifuged at 1000 ×g for 10 minutes. Supernatants were collected for cytokine analysis. Malondialdehyde (MDA), superoxide dismutase (SOD), glutathione peroxidase (GSH-px), reactive oxygen species (ROS), and myeloperoxidase (MPO) were measured by means of enzyme-linked immunosorbent assay (ELISA) (eBio, Wuhan, China) with commercially available materials. According to the manufacturer's protocol, absorbance was measured at 450 nm with High Throughput Universal Microplate Assay. The sample values were then read off the standard curve and the relative concentrations were calculated.
6
Isolation of Mammary Gland Mitochondria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mammary gland biopsies (Majorera and Palmera breeds) were disrupted in liquid nitrogen with a tissue homogenizer (Biospec, Bartlesville, OK, USA) and homogenized in sucrose (0.35 M), EDTA (1.5 M) Tris (1 mM) and BSA (1%, w/v), pH 7.4 [36 (link)]. Additional homogenization was accomplished by sonication: 3 cycles at 60 Hz during 5s (VibraCell 50-sonics & Material Inc. Danbury, CT, USA). Mitochondrial fractions were subsequently obtained by differential centrifugation. The homogenates were first centrifuged for 10 min, at 700 g and 4°C to discard cell debris. A second centrifugation for 10 min at 8800 g was performed and the mitochondrial pellet (MP1) retained. MP1 samples were washed with aminocaproic acid (ACA) (750 mM), BisTris (50 mM), Na-EDTA (0.5 mM), pH 7.0 (BN sample buffer) [37 (link)], centrifuged and the resulting mitochondrial pellet (MP2) retained for proteomic analysis.
7
Quantifying Pulmonary Inflammation in Lung Homogenate
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine pulmonary inflammation in lung homogenate, lungs were weighed and homogenized in 4 times its weight of sterile normal saline (i.e., 4 × lung weight [mg] in μL) using a tissue homogenizer (Biospec Products, Bartlesville, OK, USA). Lung homogenates were then diluted 1:1 in lysis buffer (105 nmol/L NaCl; 15 mmol/L Tris; 1 mmol/L MgCl2–H2O; 1 mmol/L CaCl2; 1 % Triton X-100; and 100 μg/mL of a mixture of protease inhibitors; pepstatin A, leupeptin, and aprotinin) and after centrifuging a cell and debris free supernatant was obtained.
8
Chick cecum RNA extraction and qPCR analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For chick RNA isolation, cecum and cecum tissue were homogenized in a tissue homogenizer (BioSpec Products, China), and RNA was isolated by Trizol reagent (Invitrogen, China) following the manufacturer's protocol and then stored at −80°C for QPCR; β-actin was used as an internal reference. QPCR was performed using SYBR Green (Applied Biosystems), PCR mix, and the appropriate primer sets (Table 2 ). QPCR reactions were run in a 10-μL reaction mixture using an ABI 7500 Detection System (Applied Biosystems, Carlsbad, CA, United States). The RNA was solubilized in RNase-free water. RNA quantity and quality were evaluated using a NanoDropTM 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA), followed by cDNA synthesis via the Transcriptor First-Strand cDNA Synthesis Kit (Roche, China) using 2 µg RNA template. The PCR procedure consisted of 95°C for 30 s, 40 cycles of 95°C for 5 s, and 60°C for 30 s.Table 2
Primers used for real-time PCR analysis.
| Gene name | Primer sequerence(5′-3′) | |
|---|---|---|
| 1 | IL-6-F | TGGTGATAAATCCCGATGAAG |
| 2 | IL-6-R | GGCACTGAAACTCCTGGTCT |
| 3 | β-actin-F | CTGGCACCTAGCACAATGAA |
| 4 | β-actin-R | CTGCTTGCTGATCCACATCT |
| 5 | PPAR-γ-F | TGGTTGACACAGAAATGCCGT |
| 6 | PPAR-γ-R | CCATTTTGATTGCACTTTGGC |
| 7 | NF-κB-F | CTCTCCCAGCCCATCTATGA |
| 8 | NF-κB-R | CCTCAGCCCAGAAACGAAC |
| 9 | TNF-α-F | GAGCGTTGACTTGGCTGTC |
| 10 | TNF-α-R | AAGCAACAACCAGCTATGCAC |
9
Potato Tissue Extraction and Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Subset of frozen tuber tissues from each time point (0, 3, 6, 9 d) were ground into a fine powder using Qiagen Tissue Lyser for 30 s (Retsch.Lab Equipment, Newtown, PA, USA). Following grinding, frozen potato tissue powder were weigh and kept in 2 mL Eppendorf centrifuge tubes and stored at -80°C.
A subset of ground tissue samples (100 mg) was transferred to glass vials and 95% ethanol (5 mL) was added. All vials were then stored at 4°C for 48 h. A tissue homogenizer (BioSpec Products Inc., Bartlesville, OK, USA) was used to homogenize the tuber tissues and the homogenate was centrifuged (10,000 g; 5 min). Collected supernatant were used to determine total soluble phenolic (TSP) content, total antioxidant activity, and phenolic profile of the tuber tissues.
For all enzyme analysis and determination of protein and proline content, ground potato tissue (400 mg) was transferred in a chilled pestle and mortar and mixed with 4 mL enzyme extraction buffer (0.5% polyvinylpyrrolidone (PVP), 0.003 M EDTA (Ethylenediaminetetraacetic acid), and 0.1 M potassium phosphate buffer; pH 7.5). Following maceration, potato tissue homogenates were centrifuged at 10,000 g for 10 min. Supernatant were collected and used for the enzyme analysis.
A subset of ground tissue samples (100 mg) was transferred to glass vials and 95% ethanol (5 mL) was added. All vials were then stored at 4°C for 48 h. A tissue homogenizer (BioSpec Products Inc., Bartlesville, OK, USA) was used to homogenize the tuber tissues and the homogenate was centrifuged (10,000 g; 5 min). Collected supernatant were used to determine total soluble phenolic (TSP) content, total antioxidant activity, and phenolic profile of the tuber tissues.
For all enzyme analysis and determination of protein and proline content, ground potato tissue (400 mg) was transferred in a chilled pestle and mortar and mixed with 4 mL enzyme extraction buffer (0.5% polyvinylpyrrolidone (PVP), 0.003 M EDTA (Ethylenediaminetetraacetic acid), and 0.1 M potassium phosphate buffer; pH 7.5). Following maceration, potato tissue homogenates were centrifuged at 10,000 g for 10 min. Supernatant were collected and used for the enzyme analysis.
10
Lung Tissue Homogenization and Cytokine Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After collecting BALF, remaining lung tissue was resected and homogenized using a tissue homogenizer (Biospec Products, Bartlesville, OK, USA) in lysis buffer and protease inhibitor solution (Sigma-Aldrich, St Louis, MO, USA). After incubation and centrifugation, supernatants were harvested and passed through a 0.45-micron filter (Gelman Science, Ann Arbor, MI, USA). The final preparations were stored at − 20℃ for cytokine analysis as described previously [17 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!