Genomic DNA is routinely extracted from mononuclear cell samples submitted to the Manchester Cancer Research Centre Haematological Tissue Biobank. Targeted sequencing for recurrent myeloid mutations, using either: (a) a 54 gene panel (TruSight™ Myeloid; Illumina), pooling 96 samples with 5% PhiX onto a single NextSeq high output, 2 × 151 bp sequencing run; VCF files were analyzed using Illumina’s Variant Studio software; (b) a 40 gene panel (Oncomine Myeloid Research Assay; ThermoFisher), processing eight samples per Ion 530 chip on the IonTorrent platform; data analysis performed using the Ion Reporter software; (c) a 27 gene custom panel (48 × 48 Access Array; Fluidigm) sequenced by Leeds HMDS on the MiSeq platform (300v2); or (d) MSK HemePACT33 targeting all coding regions of 585 genes known to be recurrently mutated in leukemias, lymphomas, and solid tumors. All panels provide sufficient coverage to detect minimum variant allele fraction 5% for all genes, except for the Access Array panel and SRSF2; all samples genotyped by this approach underwent manual Sanger sequencing of SRSF2 exon 1 using the following primers (tagged with Fluidigm Access Array sequencing adaptors CS1/CS2): Fwd: acactgacgacatggttctacacccgtttacctgcggctc, Rev: tacggtagcagagacttggtctccttcgttcgctttcacgacaa.
Access array sequencing adaptors
Manufactured by Standard BioTools
The Access Array sequencing adaptors are laboratory equipment designed for library preparation in next-generation sequencing workflows. They provide a standardized way to add universal sequencing adapters to target DNA or RNA samples, enabling efficient and reproducible sequencing results.
Automatically generated - may contain errors
2 protocols using access array sequencing adaptors
1
Targeted Sequencing for Myeloid Mutations
2
Targeted Sequencing for Myeloid Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA is routinely extracted from mononuclear cell samples submitted to the Manchester Cancer Research Centre Haematological Tissue Biobank. Targeted sequencing for recurrent myeloid mutations, using either: (a) a 54 gene panel (TruSight™ Myeloid; Illumina), pooling 96 samples with 5% PhiX onto a single NextSeq high output, 2 × 151 bp sequencing run; VCF files were analyzed using Illumina’s Variant Studio software; (b) a 40 gene panel (Oncomine Myeloid Research Assay; ThermoFisher), processing eight samples per Ion 530 chip on the IonTorrent platform; data analysis performed using the Ion Reporter software; (c) a 27 gene custom panel (48 × 48 Access Array; Fluidigm) sequenced by Leeds HMDS on the MiSeq platform (300v2); or (d) MSK HemePACT33 targeting all coding regions of 585 genes known to be recurrently mutated in leukemias, lymphomas, and solid tumors. All panels provide sufficient coverage to detect minimum variant allele fraction 5% for all genes, except for the Access Array panel and SRSF2; all samples genotyped by this approach underwent manual Sanger sequencing of SRSF2 exon 1 using the following primers (tagged with Fluidigm Access Array sequencing adaptors CS1/CS2): Fwd: acactgacgacatggttctacacccgtttacctgcggctc, Rev: tacggtagcagagacttggtctccttcgttcgctttcacgacaa.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!