RT-PCR analysis was performed using the OneStep SYBR Green PCR mix (Takara, Shiga, Japan), following the manufacturer’s instructions. The quantitative RT-PCR (qRT-PCR) was performed using a 7500 Fast Real-time PCR System (Applied Biosystems, Foster City, CA). Oligonucleotide primers were designed to produce 70–150 base amplification products. The primers used are shown in Table S1. 36B4, which encodes Rplp0 ribosomal protein, large, P0, was used as a reference gene, and the relative expression levels of each target gene were quantified using the 2−ΔΔCt method (Livak and Schmittgen 2001 (link)).
Onestep sybr green pcr mix
Manufactured by Takara Bio
Sourced in Japan
OneStep SYBR Green PCR mix is a ready-to-use solution for real-time PCR applications. It contains all the necessary components, including SYBR Green I dye, for the amplification and detection of DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
7500 fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Prism 7500, by Thermo Fisher Scientific (1 mentions)
Moloney murine leukemia virus reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
4 protocols using onestep sybr green pcr mix
1
Quantitative Real-Time PCR Analysis
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared using the RNeasy mini kit as described above. RT-PCR was performed using specific primers and One-Step SYBR Green PCR mix (Takara), according to the manufacturer's manual. qRT-PCR was performed using a Prism 7500 sequence detection system (Applied Biosystems). Samples were run in triplicate and all data were normalized to GAPDH mRNA expression as an internal control.
3
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription PCR was performed using OneStep SYBR Green PCR mix (Takara, Shiga, Japan) following the manufacturer's instructions. The qRT‐PCR was performed using a 7500 Fast Real‐time PCR System (Applied Biosystems, Foster City, CA, USA). Primers GGCTCCTCTATGATGGCCG and AAGCCTTTCTGAACAGCCAGC were used for Mest; primers AACGGTGGAGATGGATTCCA GATG and GACTTGCTGCAGAGAACTTGATCC were used for Nt5e; primers TCAGTGTACCATGATTGCCTTG and GAACCTGCTCTGCCTGTTG were used for Idi1; primers GCTCCAAGCAGATGCAGCA and CCGGATGTGAGGCAGCAG were used for 36B4; and primers GGGTGTCCTCCCTGGAAAAG and TCAGCT GAGCCACCTCATTG were used for Atf7. The reference gene 36B4 was used as a relative control, and data were analyzed using the 2−ΔΔCt method 33 .
4
RNA Expression Analysis in Porcine Muscle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from Lantang and Landrace piglet longissimus dorsi muscle with Trizol reagent (Invitrogen, Carlsbad, CA). Quality of RNA was assessed by agarose gel electrophoresis and OD260/OD280 ratios between 1.8 and 2.0. Reverse transcription was performed by use of Moloney Murine Leukemia Virus Reverse Transcriptase (Invitrogen, Carlsbad, CA). Synthesis of the cDNA first strand was performed with random primers (N10) and Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA).
The mRNA content (n = 6) was determined by real-time polymerase chain reaction (PCR) using a One-Step SYBR Green PCR Mix (Takara, Dalian, China). Primers were designed specifically for each gene by Primer 5.0 software (Table1 ). Amplification and melting curve analysis were performed on a Stratagene Mx3005P real-time PCR system (Stratagene, La Jolla, CA). Sizes of products were verified by electrophoresis on ethidium bromide-stained 1.0% agarose gels in Tris acetate-EDTA buffer. Relative mRNA expression level was calculated by application of the 2−ΔΔCt method with glyceraldehyde-phosphate dehydrogenase (GAPDH) as the housekeeping gene.
The mRNA content (n = 6) was determined by real-time polymerase chain reaction (PCR) using a One-Step SYBR Green PCR Mix (Takara, Dalian, China). Primers were designed specifically for each gene by Primer 5.0 software (Table
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!