Taqman snp genotyping assay kit

Isolation of genomic DNA from PBMCs was performed using a DNA extraction and purification kit (TAKARA, Dalian, China), according to the manufacturer’s instructions. Sequences of the PCR primers are listed in Additional file 3: Table S3. The genotypes at selected SNPs for each genomic DNA sample with PCR amplified target regions were determined using a TaqMan SNP genotyping assay kit (Thermo Fisher Scientific Inc., Waltham, MA, USA). The assay followed the protocol in the manual, and PCR reactions were conducted on an OpenArray™ real-time PCR instrument (Applied Biosystems™, Foster City, CA, USA).

Lymphocytes were classified as either homozygous ARG1 rs2781666 SNP (TT) or homozygous ARG1 rs2781666 (GG) wild type. DNA was isolated from each lymphocyte. PCR was used to determine the genotype status of the rs2781666 allele, using a Taqman SNP genotyping assay kit (Thermo Fisher Scientific, Grand Island, NY). In order to examine potential allelic differences, only lymphocytes homozygous for the TT or the GG genotypes were used in the subsequent analyses (ARG1: OMIM: 608313; NCBI Reference Sequence: NG_007086.2:g.4195G

The genomic DNA was extracted from blood samples using the GeneJet genomic DNA purification kit (Thermo-Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions and kept at −80 °C for AIRE genotyping. Two AIRE SNPs (rs2075876 G/A and rs760426 A/G) were genotyped using real-time polymerase chain reaction (PCR) by allelic discrimination assay with Taqman SNP genotyping assay kit (Thermo-Fisher Scientific, MA, USA). In a total volume of 25 µL, the extracted DNA (25 ng/3 µL) was mixed with 2xTaqman genotyping master mix (12.5 µL), 20xTaqman SNP genotyping assay (1.25 µL), and nuclease-free water. The reaction mixture was then run on an Applied Biosystem StepOne real-time PCR instrument (Foster City, CA, USA) under the following thermal cycling conditions: pre-denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 60 s. The genotypes were determined with cycle thresholds on the multicomponent plot.

The real-time polymerase chain reaction allelic discrimination technique was used to investigate the rs2285666 of ACE-2 and the rs12252 of IFITM-3 polymorphisms using the TaqMan SNP genotyping assay kit (Thermo Fisher Scientific, Waltham, MA, United States) with catalog no. C___2551626_1 and C_175677529_10, respectively, and their context sequences were as follows: (VIC/FAM) ATAATCACTACTAAAAATTAGTAGC (C/T) TACCTGGTTCAAGTAATAAGCATTC and (VIC/FAM) GCATCTCATAGTTGGGGGGCCTGG (A/G) CTGTTGACAGGAGAGAAGAAGGTT, respectively, as shown in Figures 1 and 2. The PCR mixture contained 7.5 μl of TaqMan genotyping master mix (Applied Biosystems), 0.75 μl of TaqMan SNP (probes), 1 μl of genomic DNA (1–10 ng), and 5.75 μl nuclease-free water. Thermal conditions were as follows: initial denaturation at 95°C for 10 min and 40 cycles were run at 95°C for 15 s (denaturing), followed by 60°C for 1 min (annealing/extension).

Detection of DIRC3 genetic variants was performed by quantitative polymerase chain reaction (qPCR) using the TaqMan SNP Genotyping Assay kit (Thermo Fisher Scientific) and sequencing of PCR products. The region of DIRC3 containing the polymorphism was amplified using the following oligonucleotide primer pair: forward, 5′-CAGCCTTTCATCCAGCAGGACAACAG-3′ and reverse, 5′-TCCACTGGGCGTCTCAACTACAATCTG-3′. The amplification conditions consisted of an initial denaturation at 95 °C for 15 min and then 39 cycles of denaturation at 95 °C for 15 s, annealing at 61 °C for 15 s, and extension at 72 °C for 15 s, followed by a final extension at 72 °C for 2 min. PCR was performed using a Veriti Thermal Cycler (Applied Biosystems, Foster City, CA, USA). PCR products were separated by microchip electrophoresis using the MultiNA System (Shimadzu Corporation, SHIM-POL, Poland). Amplified PCR products were purified using FastAP and Exonuclease I (Thermo Fisher Scientific). After purification of the resulting PCR products, sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing kit (Life Technologies/Thermo Fisher Scientific), and the same forward and reverse primers. The primers were diluted at a ratio of 8:42 μL in water, and PCR products were separated and analyzed on an ABI 3130 Automatic Capillary DNA Sequencer (Applied Biosystems).

The ARHGAP35 rs1052667 genotypes were analyzed by TaqMan polymerase chain reaction (PCR) on an iCycler iQ real-time PCR detection system (iQ5, Bio-Rad, Hercules, CA, USA). The corresponding TaqMan SNP Genotyping Assay Kit (cat# 4351379) was obtained from Applied Biosystems, Carlsbad, CA, USA. TaqMan PCR was performed in total volume of 25 µL consisting of 1 × TaqMAN Universal Master Mix II (cat# 4440041, Applied Biosystems), 1 × TaqMan SNP Genotyping Assay Mix (including both primers and probes, cat# C_16007053_10), and about 75 ng of genomic DNA. Cycling conditions were 95°C for 30 s, and 50 cycles of 95°C for 15 s, and 60°C for 1 min. For quality control, laboratory personnel were blinded to case and control status. Controls were included in each run, and repeated genotyping and sequencing of a random 20% subset yielded 100% identical genotypes.